Transcript: Human NM_004148.4

Homo sapiens ninjurin 1 (NINJ1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NINJ1 (4814)
Length:
1237
CDS:
35..493

Additional Resources:

NCBI RefSeq record:
NM_004148.4
NBCI Gene record:
NINJ1 (4814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004148.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063768 CCTTGTCAAGTACGACCTTAA pLKO.1 334 CDS 100% 10.800 15.120 N NINJ1 n/a
2 TRCN0000289085 CCTTGTCAAGTACGACCTTAA pLKO_005 334 CDS 100% 10.800 15.120 N NINJ1 n/a
3 TRCN0000063769 CGTGGTAGTCAACATCTTCAT pLKO.1 421 CDS 100% 4.950 3.960 N NINJ1 n/a
4 TRCN0000289088 CGTGGTAGTCAACATCTTCAT pLKO_005 421 CDS 100% 4.950 3.960 N NINJ1 n/a
5 TRCN0000063771 GCTCATCTTCCTTGTCAAGTA pLKO.1 325 CDS 100% 4.950 3.465 N NINJ1 n/a
6 TRCN0000063770 CTGGTGTTCATCATCGTGGTA pLKO.1 407 CDS 100% 2.640 1.848 N NINJ1 n/a
7 TRCN0000289033 CTGGTGTTCATCATCGTGGTA pLKO_005 407 CDS 100% 2.640 1.848 N NINJ1 n/a
8 TRCN0000063772 GCTGGACATCGCGCTGCTGAT pLKO.1 187 CDS 100% 0.000 0.000 N NINJ1 n/a
9 TRCN0000289087 GCTGGACATCGCGCTGCTGAT pLKO_005 187 CDS 100% 0.000 0.000 N NINJ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004148.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01099 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01099 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474530 CTGTTACGGCCGAGCGTTCAACTC pLX_317 67.8% 100% 100% V5 n/a
4 ccsbBroadEn_06641 pDONR223 100% 99.7% 99.3% None 329C>A n/a
5 ccsbBroad304_06641 pLX_304 0% 99.7% 99.3% V5 329C>A n/a
6 TRCN0000466561 AGGAGTTACCTCAATTTCCTCCTG pLX_317 78.9% 99.7% 99.3% V5 329C>A n/a
Download CSV