Transcript: Human NM_004431.5

Homo sapiens EPH receptor A2 (EPHA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
EPHA2 (1969)
Length:
3946
CDS:
138..3068

Additional Resources:

NCBI RefSeq record:
NM_004431.5
NBCI Gene record:
EPHA2 (1969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004431.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231646 AGAGGGCGTCATCTCCAAATA pLKO_005 2171 CDS 100% 13.200 18.480 N EPHA2 n/a
2 TRCN0000231644 TGGAAGTACGAGGTCACTTAC pLKO_005 1536 CDS 100% 10.800 15.120 N EPHA2 n/a
3 TRCN0000006404 CGTCCGTGTCTACTACAAGAA pLKO.1 716 CDS 100% 4.950 6.930 N EPHA2 n/a
4 TRCN0000195734 GATAAGTTTCTATTCTGTCAG pLKO.1 3804 3UTR 100% 4.050 5.670 N EPHA2 n/a
5 TRCN0000195690 CGATCTACATGTACTCCGTGT pLKO.1 325 CDS 100% 2.160 3.024 N EPHA2 n/a
6 TRCN0000231645 GAGACTCCAACAGCTACAATG pLKO_005 1567 CDS 100% 10.800 7.560 N EPHA2 n/a
7 TRCN0000199199 CGAGGTCACTTACCGCAAGAA pLKO.1 1544 CDS 100% 4.950 3.465 N EPHA2 n/a
8 TRCN0000006407 CTCCAAATACAAGCCCATGAT pLKO.1 2183 CDS 100% 4.950 3.465 N EPHA2 n/a
9 TRCN0000197131 GATGACCAACGACGACATCAA pLKO.1 2951 CDS 100% 4.950 3.465 N EPHA2 n/a
10 TRCN0000006406 GCGTATCTTCATTGAGCTCAA pLKO.1 413 CDS 100% 4.050 2.835 N EPHA2 n/a
11 TRCN0000006405 CCATCAAGATGCAGCAGTATA pLKO.1 2881 CDS 100% 13.200 7.920 N EPHA2 n/a
12 TRCN0000231647 CCATCAAGATGCAGCAGTATA pLKO_005 2881 CDS 100% 13.200 7.920 N EPHA2 n/a
13 TRCN0000381063 AGACTTTCAACCTCTACTATG pLKO_005 487 CDS 100% 10.800 6.480 N EPHA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004431.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14623 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14623 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472783 ACTTTAAATTTAGCCATGCGTCAT pLX_317 13.8% 100% 100% V5 n/a
4 TRCN0000491615 ATGCTCTTGGTCATTGGCCTATCC pLX_317 13.9% 99.9% 99.8% V5 (not translated due to prior stop codon) 2876C>T n/a
5 TRCN0000489900 AAAATATTGGTATGATACTCCATA pLX_317 13.8% 99.9% 99.7% V5 2876C>T;2928_2929insG n/a
6 TRCN0000491591 ACATCAATAAGTGTTTTATAATAT pLX_317 26.6% 38.8% .4% V5 (not translated due to prior stop codon) 1_1780del;1983C>T;2928_2929ins28 n/a
Download CSV