Transcript: Human NM_004477.3

Homo sapiens FSHD region gene 1 (FRG1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FRG1 (2483)
Length:
978
CDS:
139..915

Additional Resources:

NCBI RefSeq record:
NM_004477.3
NBCI Gene record:
FRG1 (2483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376533 GAAACCCAGCTTGATATTGTT pLKO_005 250 CDS 100% 5.625 3.938 N FRG1 n/a
2 TRCN0000365019 ATGGATAAGGGAACCTATATA pLKO_005 328 CDS 100% 15.000 9.000 N FRG1 n/a
3 TRCN0000370002 GGAACCAAGACGAAGAGTAAG pLKO_005 184 CDS 100% 10.800 6.480 N FRG1 n/a
4 TRCN0000075008 CCAGCTTGATATTGTTGGAAT pLKO.1 255 CDS 100% 4.950 2.970 N FRG1 n/a
5 TRCN0000365064 AGTAACAAACTTTGGTGAAAT pLKO_005 285 CDS 100% 13.200 6.600 Y FRG1 n/a
6 TRCN0000075010 GCAGTTTACGGCTGTCAAATT pLKO.1 423 CDS 100% 13.200 6.600 Y FRG1 n/a
7 TRCN0000377372 TGGCTTTGTTGGCCTCAAATA pLKO_005 578 CDS 100% 13.200 6.600 Y FRG1 n/a
8 TRCN0000075011 CGGCTGTCAAATTATCTGATT pLKO.1 431 CDS 100% 4.950 2.475 Y FRG1 n/a
9 TRCN0000075012 GACATTCCAGAAGAAGACAAA pLKO.1 715 CDS 100% 4.950 2.475 Y FRG1 n/a
10 TRCN0000168861 GATGAAGAAACCCAGCTTGAT pLKO.1 244 CDS 100% 4.950 2.475 Y FRG1BP n/a
11 TRCN0000075009 CTGTGCTGAAAGAGAAACCAA pLKO.1 684 CDS 100% 3.000 1.500 Y FRG1 n/a
12 TRCN0000168643 GAAGATGAAGAAACCCAGCTT pLKO.1 241 CDS 100% 2.640 1.320 Y FRG1BP n/a
13 TRCN0000437155 AGTCCTCCAGAGCAGTTTACT pLKO_005 412 CDS 100% 5.625 2.813 Y Frg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00591 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00591 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471935 TTCCGACCATTCAACCTACGAGGA pLX_317 7.9% 100% 100% V5 n/a
4 ccsbBroadEn_13507 pDONR223 100% 38.7% 36.3% None (many diffs) n/a
5 ccsbBroad304_13507 pLX_304 0% 38.7% 36.3% V5 (many diffs) n/a
6 TRCN0000475567 TTCGAAGTGTCGGAGGTTAAGAGA pLX_317 72.9% 38.7% 36.3% V5 (many diffs) n/a
Download CSV