Transcript: Human NM_004508.3

Homo sapiens isopentenyl-diphosphate delta isomerase 1 (IDI1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
IDI1 (3422)
Length:
2996
CDS:
364..1218

Additional Resources:

NCBI RefSeq record:
NM_004508.3
NBCI Gene record:
IDI1 (3422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049173 CGTGTTGTAGTCATCCATTAA pLKO.1 785 CDS 100% 13.200 9.240 N IDI1 n/a
2 TRCN0000290654 CGTGTTGTAGTCATCCATTAA pLKO_005 785 CDS 100% 13.200 9.240 N IDI1 n/a
3 TRCN0000049174 GCCAGTGGTGAAATTAAGATA pLKO.1 1093 CDS 100% 5.625 3.938 N IDI1 n/a
4 TRCN0000290723 GCCAGTGGTGAAATTAAGATA pLKO_005 1093 CDS 100% 5.625 3.938 N IDI1 n/a
5 TRCN0000049177 TGGTGGGATAACTTAAATCAT pLKO.1 1156 CDS 100% 5.625 3.938 N IDI1 n/a
6 TRCN0000290653 TGGTGGGATAACTTAAATCAT pLKO_005 1156 CDS 100% 5.625 3.938 N IDI1 n/a
7 TRCN0000049176 ACAGCAAAGATCAGATGCTAA pLKO.1 735 CDS 100% 4.950 3.465 N IDI1 n/a
8 TRCN0000049175 CCAGATCCCAATGAGATTAAA pLKO.1 1021 CDS 100% 15.000 9.000 N IDI1 n/a
9 TRCN0000290725 CCAGATCCCAATGAGATTAAA pLKO_005 1021 CDS 100% 15.000 9.000 N IDI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004508.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10897 pDONR223 100% 80.2% 80.2% None 1_168del n/a
2 TRCN0000473963 TCAAGCGGATCTCGCTTAGTCTGT pLX_317 74.7% 80.2% 80.2% V5 1_168del n/a
3 ccsbBroadEn_10898 pDONR223 100% 80.1% 79.9% None 1_168del;472G>A n/a
4 ccsbBroad304_10898 pLX_304 0% 80.1% 79.9% V5 1_168del;472G>A n/a
5 TRCN0000471142 CTAAGACAGGCGATTACCCGGCTA pLX_317 61.9% 80.1% 79.9% V5 1_168del;472G>A n/a
6 ccsbBroadEn_15460 pDONR223 0% 80.1% 79.9% None 1_168del;688T>C n/a
7 ccsbBroad304_15460 pLX_304 0% 80.1% 79.9% V5 1_168del;688T>C n/a
8 TRCN0000479160 TTTGCTGATTAGCCTGACGATGTA pLX_317 59% 80.1% 79.9% V5 1_168del;688T>C n/a
Download CSV