Transcript: Human NM_005157.3:c.1052T>C

NM_005157.3(ABL1):c.1052T>C

Taxon:
Homo sapiens (human)
Gene:
ABL1 (25)
Length:
5384
CDS:
4..3396

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005157.3:c.1052T>C, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121279 CCTCAGTTCGGTGAAGGAAAT pLKO.1 3354 CDS 100% 10.800 15.120 N ABL1 n/a
2 TRCN0000288647 CCTCAGTTCGGTGAAGGAAAT pLKO_005 3354 CDS 100% 10.800 15.120 N ABL1 n/a
3 TRCN0000010626 CCGAGTTGGTTCATCATCATT pLKO.1 590 CDS 100% 5.625 7.875 N ABL1 n/a
4 TRCN0000121101 CCGGGTCTTAGGCTATAATCA pLKO.1 267 CDS 100% 5.625 7.875 N ABL1 n/a
5 TRCN0000001499 CCAGCTCTACTACCTACGTTT pLKO.1 3549 3UTR 100% 4.950 6.930 N ABL1 n/a
6 TRCN0000121099 CGTGAGCTATGTGGATTCCAT pLKO.1 3204 CDS 100% 3.000 4.200 N ABL1 n/a
7 TRCN0000121170 GAGAATAATCTCCGGGAGCTT pLKO.1 3274 CDS 100% 2.640 3.696 N ABL1 n/a
8 TRCN0000121278 GCGGCCAGTAGCATCTGACTT pLKO.1 93 CDS 100% 1.650 2.310 N ABL1 n/a
9 TRCN0000121100 CCGCCTTCATCCCTCTCATAT pLKO.1 3002 CDS 100% 13.200 10.560 N ABL1 n/a
10 TRCN0000121169 CAACTACGACAAGTGGGAGAT pLKO.1 693 CDS 100% 4.050 3.240 N ABL1 n/a
11 TRCN0000039900 GCTGAAATCCACCAAGCCTTT pLKO.1 1462 CDS 100% 4.050 3.240 N ABL1 n/a
12 TRCN0000332951 GCTGAAATCCACCAAGCCTTT pLKO_005 1462 CDS 100% 4.050 3.240 N ABL1 n/a
13 TRCN0000001501 CCCGTTCTATATCATCACTGA pLKO.1 930 CDS 100% 2.640 2.112 N ABL1 n/a
14 TRCN0000010289 TAATTACCGTGAGTGACATAG pLKO.1 4607 3UTR 100% 10.800 7.560 N ABL1 n/a
15 TRCN0000121097 CCACTCCTCTAAGACAAAGTA pLKO.1 4388 3UTR 100% 5.625 3.938 N ABL1 n/a
16 TRCN0000001502 CCTTCATCCCTCTCATATCAA pLKO.1 3005 CDS 100% 5.625 3.938 N ABL1 n/a
17 TRCN0000039901 GCAGTCATGAAAGAGATCAAA pLKO.1 865 CDS 100% 5.625 3.938 N ABL1 n/a
18 TRCN0000333012 GCAGTCATGAAAGAGATCAAA pLKO_005 865 CDS 100% 5.625 3.938 N ABL1 n/a
19 TRCN0000121168 ACAGTTTGACTCGTCCACATT pLKO.1 2238 CDS 100% 4.950 3.465 N ABL1 n/a
20 TRCN0000121281 ACTTGGTGAAGGTAGCTGATT pLKO.1 1127 CDS 100% 4.950 3.465 N ABL1 n/a
21 TRCN0000288588 ACTTGGTGAAGGTAGCTGATT pLKO_005 1127 CDS 100% 4.950 3.465 N ABL1 n/a
22 TRCN0000039902 CCAGTCAACAGTCTGGAGAAA pLKO.1 355 CDS 100% 4.950 3.465 N ABL1 n/a
23 TRCN0000121098 CCAGTGGAGATAACACTCTAA pLKO.1 224 CDS 100% 4.950 3.465 N ABL1 n/a
24 TRCN0000039899 GCCATCAACAAACTGGAGAAT pLKO.1 3259 CDS 100% 4.950 3.465 N ABL1 n/a
25 TRCN0000039898 GCCGAGTTGGTTCATCATCAT pLKO.1 589 CDS 100% 4.950 3.465 N ABL1 n/a
26 TRCN0000001500 GAAAGAGATCAAACACCCTAA pLKO.1 873 CDS 100% 4.050 2.835 N ABL1 n/a
27 TRCN0000121280 GCTTTGGGAAATTGCTACCTA pLKO.1 1287 CDS 100% 3.000 2.100 N ABL1 n/a
28 TRCN0000121277 GAGTTCTTGAAGCATTTCAAA pLKO.1 4458 3UTR 100% 0.563 0.394 N ABL1 n/a
29 TRCN0000288648 GAGTTCTTGAAGCATTTCAAA pLKO_005 4458 3UTR 100% 0.563 0.394 N ABL1 n/a
30 TRCN0000195504 CTGCTGATGAGGTCTTCAAAG pLKO.1 2381 CDS 100% 10.800 6.480 N ABL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005157.3:c.1052T>C, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14525 pDONR223 0% 99.9% 99.9% None 1052C>T n/a
2 ccsbBroad304_14525 pLX_304 0% 99.9% 99.9% V5 1052C>T n/a
3 TRCN0000474000 CGACTCCTGGAGTTTTTCATCTAT pLX_317 13.2% 99.9% 99.9% V5 1052C>T;3075C>T;3390delG n/a
4 TRCN0000488091 GTGAACTGATCCAACGTAAGCTCG pLX_317 10.2% 99.9% 100% V5 (not translated due to prior stop codon) 3324A>G n/a
5 TRCN0000491940 CAGCACAACACGTATGAATTGTCG pLX_317 9.5% 99.9% 99.8% V5 (not translated due to prior stop codon) 763G>A;1052C>T;3324A>G n/a
6 TRCN0000489115 CTGGTATAGCACCAATTGGAATTC pLX_317 10.2% 99.9% 99.8% V5 (not translated due to prior stop codon) 951C>A;1052C>T;3324A>G n/a
7 TRCN0000489646 CCAGTCTGCGTCTGTTACGCTGCG pLX_317 12% 99.9% 99.8% V5 (not translated due to prior stop codon) 1052C>T;1187A>C;3324A>G n/a
8 TRCN0000489555 TTAGATTATTATAAGACCCGGGCC pLX_317 11.6% 99.9% 99.8% V5 (not translated due to prior stop codon) 756G>T;1052C>T;3324A>G n/a
9 TRCN0000489612 CGATTCCTAACACCTTCTAACGTC pLX_317 12% 99.9% 99.8% V5 (not translated due to prior stop codon) 944C>T;1052C>T;3324A>G n/a
10 TRCN0000487758 ACTTAAACCATCCTAGGAACAGTC pLX_317 8.6% 99.9% 99.8% V5 (not translated due to prior stop codon) 758A>T;1052C>T;3324A>G n/a
Download CSV