Transcript: Human NM_005157.6

Homo sapiens ABL proto-oncogene 1, non-receptor tyrosine kinase (ABL1), transcript variant a, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ABL1 (25)
Length:
5578
CDS:
194..3586

Additional Resources:

NCBI RefSeq record:
NM_005157.6
NBCI Gene record:
ABL1 (25)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147538 TCAGTGATGATATAGAACGG pXPR_003 GGG 930 27% 6 1.2817 ABL1 ABL1 77735
2 BRDN0001147582 CTTAGGCTATAATCACAATG pXPR_003 GGG 286 8% 3 0.6179 ABL1 ABL1 77732
3 BRDN0001145303 GGTTCATCATCATTCAACGG pXPR_003 TGG 610 18% 4 0.4423 ABL1 ABL1 77733
4 BRDN0001145259 TTGCTCCCTCGAAAAGAGCG pXPR_003 AGG 1727 51% 11 -0.6063 ABL1 ABL1 77734
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005157.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121279 CCTCAGTTCGGTGAAGGAAAT pLKO.1 3544 CDS 100% 10.800 15.120 N ABL1 n/a
2 TRCN0000288647 CCTCAGTTCGGTGAAGGAAAT pLKO_005 3544 CDS 100% 10.800 15.120 N ABL1 n/a
3 TRCN0000010626 CCGAGTTGGTTCATCATCATT pLKO.1 780 CDS 100% 5.625 7.875 N ABL1 n/a
4 TRCN0000121101 CCGGGTCTTAGGCTATAATCA pLKO.1 457 CDS 100% 5.625 7.875 N ABL1 n/a
5 TRCN0000001499 CCAGCTCTACTACCTACGTTT pLKO.1 3739 3UTR 100% 4.950 6.930 N ABL1 n/a
6 TRCN0000121099 CGTGAGCTATGTGGATTCCAT pLKO.1 3394 CDS 100% 3.000 4.200 N ABL1 n/a
7 TRCN0000121170 GAGAATAATCTCCGGGAGCTT pLKO.1 3464 CDS 100% 2.640 3.696 N ABL1 n/a
8 TRCN0000121278 GCGGCCAGTAGCATCTGACTT pLKO.1 283 CDS 100% 1.650 2.310 N ABL1 n/a
9 TRCN0000121100 CCGCCTTCATCCCTCTCATAT pLKO.1 3192 CDS 100% 13.200 10.560 N ABL1 n/a
10 TRCN0000121169 CAACTACGACAAGTGGGAGAT pLKO.1 883 CDS 100% 4.050 3.240 N ABL1 n/a
11 TRCN0000039900 GCTGAAATCCACCAAGCCTTT pLKO.1 1652 CDS 100% 4.050 3.240 N ABL1 n/a
12 TRCN0000332951 GCTGAAATCCACCAAGCCTTT pLKO_005 1652 CDS 100% 4.050 3.240 N ABL1 n/a
13 TRCN0000001501 CCCGTTCTATATCATCACTGA pLKO.1 1120 CDS 100% 2.640 2.112 N ABL1 n/a
14 TRCN0000010289 TAATTACCGTGAGTGACATAG pLKO.1 4797 3UTR 100% 10.800 7.560 N ABL1 n/a
15 TRCN0000121097 CCACTCCTCTAAGACAAAGTA pLKO.1 4578 3UTR 100% 5.625 3.938 N ABL1 n/a
16 TRCN0000001502 CCTTCATCCCTCTCATATCAA pLKO.1 3195 CDS 100% 5.625 3.938 N ABL1 n/a
17 TRCN0000039901 GCAGTCATGAAAGAGATCAAA pLKO.1 1055 CDS 100% 5.625 3.938 N ABL1 n/a
18 TRCN0000333012 GCAGTCATGAAAGAGATCAAA pLKO_005 1055 CDS 100% 5.625 3.938 N ABL1 n/a
19 TRCN0000121168 ACAGTTTGACTCGTCCACATT pLKO.1 2428 CDS 100% 4.950 3.465 N ABL1 n/a
20 TRCN0000121281 ACTTGGTGAAGGTAGCTGATT pLKO.1 1317 CDS 100% 4.950 3.465 N ABL1 n/a
21 TRCN0000288588 ACTTGGTGAAGGTAGCTGATT pLKO_005 1317 CDS 100% 4.950 3.465 N ABL1 n/a
22 TRCN0000039902 CCAGTCAACAGTCTGGAGAAA pLKO.1 545 CDS 100% 4.950 3.465 N ABL1 n/a
23 TRCN0000121098 CCAGTGGAGATAACACTCTAA pLKO.1 414 CDS 100% 4.950 3.465 N ABL1 n/a
24 TRCN0000039899 GCCATCAACAAACTGGAGAAT pLKO.1 3449 CDS 100% 4.950 3.465 N ABL1 n/a
25 TRCN0000039898 GCCGAGTTGGTTCATCATCAT pLKO.1 779 CDS 100% 4.950 3.465 N ABL1 n/a
26 TRCN0000001500 GAAAGAGATCAAACACCCTAA pLKO.1 1063 CDS 100% 4.050 2.835 N ABL1 n/a
27 TRCN0000121280 GCTTTGGGAAATTGCTACCTA pLKO.1 1477 CDS 100% 3.000 2.100 N ABL1 n/a
28 TRCN0000121277 GAGTTCTTGAAGCATTTCAAA pLKO.1 4648 3UTR 100% 0.563 0.394 N ABL1 n/a
29 TRCN0000288648 GAGTTCTTGAAGCATTTCAAA pLKO_005 4648 3UTR 100% 0.563 0.394 N ABL1 n/a
30 TRCN0000195504 CTGCTGATGAGGTCTTCAAAG pLKO.1 2571 CDS 100% 10.800 6.480 N ABL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005157.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14525 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14525 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474000 CGACTCCTGGAGTTTTTCATCTAT pLX_317 13.2% 99.9% 100% V5 3075C>T;3390delG n/a
4 TRCN0000491940 CAGCACAACACGTATGAATTGTCG pLX_317 9.5% 99.9% 99.9% V5 (not translated due to prior stop codon) 763G>A;3324A>G n/a
5 TRCN0000489115 CTGGTATAGCACCAATTGGAATTC pLX_317 10.2% 99.9% 99.9% V5 (not translated due to prior stop codon) 951C>A;3324A>G n/a
6 TRCN0000489646 CCAGTCTGCGTCTGTTACGCTGCG pLX_317 12% 99.9% 99.9% V5 (not translated due to prior stop codon) 1187A>C;3324A>G n/a
7 TRCN0000488091 GTGAACTGATCCAACGTAAGCTCG pLX_317 10.2% 99.9% 99.9% V5 (not translated due to prior stop codon) 1052T>C;3324A>G n/a
8 TRCN0000489555 TTAGATTATTATAAGACCCGGGCC pLX_317 11.6% 99.9% 99.9% V5 (not translated due to prior stop codon) 756G>T;3324A>G n/a
9 TRCN0000489612 CGATTCCTAACACCTTCTAACGTC pLX_317 12% 99.9% 99.9% V5 (not translated due to prior stop codon) 944C>T;3324A>G n/a
10 TRCN0000487758 ACTTAAACCATCCTAGGAACAGTC pLX_317 8.6% 99.9% 99.9% V5 (not translated due to prior stop codon) 758A>T;3324A>G n/a
Download CSV