Transcript: Human NM_005217.4

Homo sapiens defensin alpha 3 (DEFA3), mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
DEFA3 (1668)
Length:
494
CDS:
89..373

Additional Resources:

NCBI RefSeq record:
NM_005217.4
NBCI Gene record:
DEFA3 (1668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005217.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056794 CATGGACTGCTATTGCAGAAT pLKO.1 277 CDS 100% 4.950 2.970 N DEFA3 n/a
2 TRCN0000256383 CATCCCAGAAGTGGTTGTTTC pLKO_005 205 CDS 100% 10.800 5.400 Y DEFA1B n/a
3 TRCN0000265786 GACGAAAGCTTGGCTCCAAAG pLKO_005 236 CDS 100% 6.000 3.000 Y DEFA1B n/a
4 TRCN0000372085 TTCCCTTGCATGGGACGAAAG pLKO_005 223 CDS 100% 6.000 3.000 Y DEFA3 n/a
5 TRCN0000256384 TTGCAGGAGAACGTCGCTATG pLKO_005 309 CDS 100% 6.000 3.000 Y DEFA1B n/a
6 TRCN0000056797 ACATCCCAGAAGTGGTTGTTT pLKO.1 204 CDS 100% 5.625 2.813 Y DEFA3 n/a
7 TRCN0000056796 TCGCTATGGAACCTGCATCTA pLKO.1 322 CDS 100% 4.950 2.475 Y DEFA3 n/a
8 TRCN0000056981 TGCAGAATACCAGCGTGCATT pLKO.1 290 CDS 100% 4.950 2.475 Y DEFA1 n/a
9 TRCN0000436983 ACCTGCATCTACCAGGGAAGA pLKO_005 332 CDS 100% 4.050 2.025 Y DEFA1 n/a
10 TRCN0000265797 AGGCAAGAGCTGATGAGGTTG pLKO_005 156 CDS 100% 4.050 2.025 Y DEFA1B n/a
11 TRCN0000372030 CAAAGCATCCAGGCTCAAGGA pLKO_005 252 CDS 100% 2.640 1.320 Y DEFA3 n/a
12 TRCN0000056793 CCAGAAGTGGTTGTTTCCCTT pLKO.1 209 CDS 100% 2.640 1.320 Y DEFA3 n/a
13 TRCN0000056795 CCAGCGTGCATTGCAGGAGAA pLKO.1 299 CDS 100% 1.350 0.675 Y DEFA3 n/a
14 TRCN0000056979 CCAGGGAAGACTCTGGGCATT pLKO.1 343 CDS 100% 1.350 0.675 Y DEFA1 n/a
15 TRCN0000056982 CGGAGCAGATTGCAGCGGACA pLKO.1 186 CDS 100% 0.000 0.000 Y DEFA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005217.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00435 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00435 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473680 ATTTTGTTGGGGTTAGCCCAGGAT pLX_317 91.3% 100% 100% V5 n/a
4 ccsbBroadEn_00434 pDONR223 100% 99.6% 98.9% None 194A>C n/a
5 ccsbBroad304_00434 pLX_304 0% 99.6% 98.9% V5 194A>C n/a
6 TRCN0000472137 CAGCTGTCGGACACTTCTATCACC pLX_317 100% 99.6% 98.9% V5 194A>C n/a
Download CSV