Transcript: Human NM_005273.4

Homo sapiens G protein subunit beta 2 (GNB2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GNB2 (2783)
Length:
1664
CDS:
274..1296

Additional Resources:

NCBI RefSeq record:
NM_005273.4
NBCI Gene record:
GNB2 (2783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005273.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029523 CGGCCATGAATCCGACATCAA pLKO.1 942 CDS 100% 4.950 3.960 N GNB2 n/a
2 TRCN0000278922 CGGCCATGAATCCGACATCAA pLKO_005 942 CDS 100% 4.950 3.960 N GNB2 n/a
3 TRCN0000029522 CCTGGATGACAACCAAATCAT pLKO.1 726 CDS 100% 5.625 3.938 N GNB2 n/a
4 TRCN0000278856 CCTGGATGACAACCAAATCAT pLKO_005 726 CDS 100% 5.625 3.938 N GNB2 n/a
5 TRCN0000029520 CCTCATGTACTCCCATGACAA pLKO.1 1056 CDS 100% 0.495 0.347 N GNB2 n/a
6 TRCN0000278854 CCTCATGTACTCCCATGACAA pLKO_005 1056 CDS 100% 0.495 0.347 N GNB2 n/a
7 TRCN0000029521 CGACATCAATGCAGTGGCTTT pLKO.1 954 CDS 100% 4.050 2.430 N GNB2 n/a
8 TRCN0000297572 CGACATCAATGCAGTGGCTTT pLKO_005 954 CDS 100% 4.050 2.430 N GNB2 n/a
9 TRCN0000029519 GCCCTGCCCATGCCCACACTA pLKO.1 1331 3UTR 100% 0.000 0.000 N GNB2 n/a
10 TRCN0000278855 GCCCTGCCCATGCCCACACTA pLKO_005 1331 3UTR 100% 0.000 0.000 N GNB2 n/a
11 TRCN0000109292 CGACGACTTCAACTGCAACAT pLKO.1 1140 CDS 100% 4.950 2.475 Y Gnb2 n/a
12 TRCN0000331994 CGACGACTTCAACTGCAACAT pLKO_005 1140 CDS 100% 4.950 2.475 Y Gnb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005273.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00655 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00655 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472058 GGGAACAATCACATTGATCACTTT pLX_317 45.7% 100% 100% V5 n/a
4 ccsbBroadEn_06297 pDONR223 100% 99.9% 100% None 954C>T n/a
5 ccsbBroad304_06297 pLX_304 0% 99.9% 100% V5 954C>T n/a
6 TRCN0000475025 GATTCCCGACGGCGCCTATTGAGT pLX_317 50.8% 99.9% 100% V5 954C>T n/a
7 ccsbBroadEn_00654 pDONR223 100% 78.6% 90.2% None (many diffs) n/a
8 ccsbBroad304_00654 pLX_304 0% 78.6% 90.2% V5 (many diffs) n/a
9 TRCN0000469902 TCTGGTCGCGCACGCAAGCGGTAA pLX_317 41.4% 78.6% 90.2% V5 (many diffs) n/a
Download CSV