Transcript: Human NM_005415.5

Homo sapiens solute carrier family 20 member 1 (SLC20A1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC20A1 (6574)
Length:
3297
CDS:
458..2497

Additional Resources:

NCBI RefSeq record:
NM_005415.5
NBCI Gene record:
SLC20A1 (6574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005415.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043057 CCATCAGTACAACACATTGTA pLKO.1 2313 CDS 100% 0.563 0.788 N SLC20A1 n/a
2 TRCN0000289801 CCATCAGTACAACACATTGTA pLKO_005 2313 CDS 100% 0.563 0.788 N SLC20A1 n/a
3 TRCN0000296390 CTCACATGCACAGGGATTTAA pLKO_005 2906 3UTR 100% 15.000 10.500 N SLC20A1 n/a
4 TRCN0000043055 CCAGTATCACACCGTGCATAA pLKO.1 1585 CDS 100% 10.800 7.560 N SLC20A1 n/a
5 TRCN0000289800 CCAGTATCACACCGTGCATAA pLKO_005 1585 CDS 100% 10.800 7.560 N SLC20A1 n/a
6 TRCN0000043053 GCCCTTATCGTCTGGTTCTTT pLKO.1 1184 CDS 100% 5.625 3.938 N SLC20A1 n/a
7 TRCN0000306853 GCCCTTATCGTCTGGTTCTTT pLKO_005 1184 CDS 100% 5.625 3.938 N SLC20A1 n/a
8 TRCN0000043054 CCTGGGCTTCATTATTGCATT pLKO.1 535 CDS 100% 4.950 3.465 N SLC20A1 n/a
9 TRCN0000043056 CCCATTGTATTGTTGGTGCAA pLKO.1 846 CDS 100% 2.640 1.848 N SLC20A1 n/a
10 TRCN0000289734 CCCATTGTATTGTTGGTGCAA pLKO_005 846 CDS 100% 2.640 1.848 N SLC20A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005415.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01551 pDONR223 100% 99.9% 100% None 303G>A n/a
2 ccsbBroad304_01551 pLX_304 0% 99.9% 100% V5 303G>A n/a
3 TRCN0000479800 ACTTAGTCTTTACCCATGGCTTCA pLX_317 9.1% 99.9% 100% V5 303G>A n/a
Download CSV