Transcript: Human NM_005541.5

Homo sapiens inositol polyphosphate-5-phosphatase D (INPP5D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
INPP5D (3635)
Length:
4899
CDS:
138..3704

Additional Resources:

NCBI RefSeq record:
NM_005541.5
NBCI Gene record:
INPP5D (3635)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005541.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010362 GAATTGCGTTTACACTTACAG pLKO.1 278 CDS 100% 4.950 6.930 N INPP5D n/a
2 TRCN0000010364 GATTTGAGGGTGGAGATATAG pLKO.1 4018 3UTR 100% 13.200 9.240 N INPP5D n/a
3 TRCN0000039894 GCTCATTAAGTCACAGAAATT pLKO.1 1172 CDS 100% 13.200 9.240 N INPP5D n/a
4 TRCN0000039897 GCCTTCCAGATCGGAAATCAA pLKO.1 3503 CDS 100% 5.625 3.938 N INPP5D n/a
5 TRCN0000039893 GCTAAGTGCTTTACGAACATT pLKO.1 4105 3UTR 100% 5.625 3.938 N INPP5D n/a
6 TRCN0000039896 GCAGAAGGTCTTCCTACACTT pLKO.1 2012 CDS 100% 4.950 3.465 N INPP5D n/a
7 TRCN0000039895 GCCCATATCACCCAAGAAGTT pLKO.1 3038 CDS 100% 4.950 3.465 N INPP5D n/a
8 TRCN0000010363 GATTGAGTTTCTCAGGTGCTA pLKO.1 2324 CDS 100% 2.640 1.848 N INPP5D n/a
9 TRCN0000436483 CGAGTCCTCTGGAAGTCTTAC pLKO_005 2154 CDS 100% 10.800 15.120 N Inpp5d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005541.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15481 pDONR223 0% 99.9% 100% None 816G>A n/a
2 ccsbBroad304_15481 pLX_304 0% 99.9% 100% V5 816G>A n/a
3 TRCN0000488390 TGCCACGGACGGGCCTACGCTCCA pLX_317 7.9% 99.8% 99.9% V5 (not translated due to prior stop codon) 347_348insAGT;816G>A n/a
Download CSV