Transcript: Human NM_005544.2

Homo sapiens insulin receptor substrate 1 (IRS1), mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
IRS1 (3667)
Length:
8743
CDS:
53..3781

Additional Resources:

NCBI RefSeq record:
NM_005544.2
NBCI Gene record:
IRS1 (3667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231148 GGAGGAGCTAAGCAACTATAT pLKO_005 1429 CDS 100% 13.200 18.480 N IRS1 n/a
2 TRCN0000218908 ACTCATTGCCAAGATCCTTTA pLKO_005 2346 CDS 100% 10.800 8.640 N IRS1 n/a
3 TRCN0000039909 GCCGCTCAAGTGAGGATTTAA pLKO.1 3711 CDS 100% 15.000 10.500 N IRS1 n/a
4 TRCN0000231150 GCCGCTCAAGTGAGGATTTAA pLKO_005 3711 CDS 100% 15.000 10.500 N IRS1 n/a
5 TRCN0000231151 GGCATCAAACTACCGATTTAA pLKO_005 6233 3UTR 100% 15.000 10.500 N IRS1 n/a
6 TRCN0000231149 GGGTTTGGAGAATGGTCTTAA pLKO_005 3565 CDS 100% 13.200 9.240 N IRS1 n/a
7 TRCN0000039908 CCTCAGCAAATCCTCTTCTAA pLKO.1 3820 3UTR 100% 5.625 3.938 N IRS1 n/a
8 TRCN0000039910 CCCTGTAAGCTATGCTGACAT pLKO.1 3076 CDS 100% 4.950 3.465 N IRS1 n/a
9 TRCN0000039912 CCTACTACTCATTGCCAAGAT pLKO.1 2340 CDS 100% 4.950 3.465 N IRS1 n/a
10 TRCN0000039911 GCTAAGCAACTATATCTGCAT pLKO.1 1435 CDS 100% 2.640 1.848 N IRS1 n/a
11 TRCN0000009844 CAGAATGAAGACCTAAATGAC pLKO.1 3800 3UTR 100% 4.950 2.970 N IRS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00882 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00882 pLX_304 15.2% 100% 100% V5 n/a
3 TRCN0000472387 CGGGCCTTGCAACTATCGGTTGCG pLX_317 6% 100% 100% V5 n/a
Download CSV