Transcript: Human NM_005684.5

Homo sapiens G protein-coupled receptor 52 (GPR52), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GPR52 (9293)
Length:
1582
CDS:
149..1234

Additional Resources:

NCBI RefSeq record:
NM_005684.5
NBCI Gene record:
GPR52 (9293)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005684.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356455 ACCTAGGAAACGGGCTAATTC pLKO_005 1201 CDS 100% 13.200 18.480 N GPR52 n/a
2 TRCN0000011604 CCAAAGAGATAAATGACCGAA pLKO.1 849 CDS 100% 2.640 2.112 N GPR52 n/a
3 TRCN0000011601 GCTCCACTGTTACATCATTAT pLKO.1 350 CDS 100% 13.200 9.240 N GPR52 n/a
4 TRCN0000356456 TGCTCCACTGTTACATCATTA pLKO_005 349 CDS 100% 13.200 9.240 N GPR52 n/a
5 TRCN0000356457 GATCATTGCTGGGAATCTAAC pLKO_005 307 CDS 100% 10.800 7.560 N GPR52 n/a
6 TRCN0000217970 TTGTCTGCTTCACTTACTTTC pLKO_005 801 CDS 100% 10.800 7.560 N Gpr52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005684.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07387 pDONR223 100% 99.9% 100% None 693T>C n/a
2 ccsbBroad304_07387 pLX_304 0% 99.9% 100% V5 693T>C n/a
3 TRCN0000474792 AGAGGGCTCGGCTTGAACCCCTGC pLX_317 36.8% 99.9% 100% V5 693T>C n/a
4 ccsbBroadEn_15664 pDONR223 0% 99.9% 100% None 390A>G n/a
5 ccsbBroad304_15664 pLX_304 0% 99.9% 100% V5 390A>G n/a
6 TRCN0000481563 ATTTAAACGTCCCCCTTCCGGCAG pLX_317 38% 99.9% 100% V5 390A>G n/a
7 TRCN0000488227 CGAGGAACTTGGTTTTAACTCCGC pLX_317 27.9% 99.9% 100% V5 (not translated due to prior stop codon) 105T>C n/a
8 TRCN0000488426 GCTACACTCCTGGTGTAAGCTGGG pLX_317 28.6% 99.8% 99.7% V5 105T>C;1083_1084insG n/a
Download CSV