Transcript: Human NM_005742.4

Homo sapiens protein disulfide isomerase family A member 6 (PDIA6), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PDIA6 (10130)
Length:
2279
CDS:
90..1412

Additional Resources:

NCBI RefSeq record:
NM_005742.4
NBCI Gene record:
PDIA6 (10130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005742.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049356 CGATACGGGATTAGAGGATTT pLKO.1 780 CDS 100% 10.800 15.120 N PDIA6 n/a
2 TRCN0000049354 GAGATTATCAACGAGGACATT pLKO.1 927 CDS 100% 4.950 6.930 N PDIA6 n/a
3 TRCN0000049353 CCATCGAATTTCAACCGAGAA pLKO.1 183 CDS 100% 4.050 5.670 N PDIA6 n/a
4 TRCN0000429556 GATGAAATTTGCTCTGCTAAA pLKO_005 1187 CDS 100% 10.800 8.640 N PDIA6 n/a
5 TRCN0000433473 AGTTAGTATCCACATCATAAA pLKO_005 1823 3UTR 100% 13.200 9.240 N PDIA6 n/a
6 TRCN0000444319 GCGAGTCTCCTGTGGATTATG pLKO_005 826 CDS 100% 13.200 9.240 N PDIA6 n/a
7 TRCN0000433401 GTAGTACTTGATTGGTCATTT pLKO_005 1530 3UTR 100% 13.200 9.240 N PDIA6 n/a
8 TRCN0000416687 AGAAGTGATAGTTCAAGTAAG pLKO_005 546 CDS 100% 10.800 7.560 N PDIA6 n/a
9 TRCN0000433707 AGCAAGGCATCAACGAGTTTC pLKO_005 1222 CDS 100% 10.800 7.560 N PDIA6 n/a
10 TRCN0000049355 GCAGATAAGCATCATTCCCTA pLKO.1 336 CDS 100% 2.640 1.848 N PDIA6 n/a
11 TRCN0000049357 CGAGAAGTTATTCAGAGTGAT pLKO.1 198 CDS 100% 4.950 2.970 N PDIA6 n/a
12 TRCN0000111774 CGCAAGATGAAATTTGCTCTT pLKO.1 1182 CDS 100% 4.050 2.835 N Pdia6 n/a
13 TRCN0000349085 CGCAAGATGAAATTTGCTCTT pLKO_005 1182 CDS 100% 4.050 2.835 N Pdia6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005742.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02323 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02323 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470664 TGTACCGAAAAATACCTCCTATGG pLX_317 37.5% 100% 100% V5 n/a
Download CSV