Transcript: Human NM_005998.5

Homo sapiens chaperonin containing TCP1 subunit 3 (CCT3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CCT3 (7203)
Length:
1977
CDS:
109..1746

Additional Resources:

NCBI RefSeq record:
NM_005998.5
NBCI Gene record:
CCT3 (7203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005998.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156792 GCCAGAACACAAAGCGTGAAT pLKO.1 140 CDS 100% 4.950 3.960 N CCT3 n/a
2 TRCN0000343602 GCCAGAACACAAAGCGTGAAT pLKO_005 140 CDS 100% 4.950 3.960 N CCT3 n/a
3 TRCN0000155458 GCCAAGTCCATGATCGAAATT pLKO.1 337 CDS 100% 13.200 9.240 N CCT3 n/a
4 TRCN0000343663 GCCAAGTCCATGATCGAAATT pLKO_005 337 CDS 100% 13.200 9.240 N CCT3 n/a
5 TRCN0000158114 CCATGACTGGTGTGGAACAAT pLKO.1 1391 CDS 100% 5.625 3.938 N CCT3 n/a
6 TRCN0000156740 GACATCGTTTCAGGCCACAAA pLKO.1 1669 CDS 100% 4.950 3.465 N CCT3 n/a
7 TRCN0000154461 GCTACTGCGAATTGATGACAT pLKO.1 1653 CDS 100% 4.950 3.465 N CCT3 n/a
8 TRCN0000157145 GCTGCCAAGACTATTGCAGAT pLKO.1 193 CDS 100% 4.050 2.835 N CCT3 n/a
9 TRCN0000343662 GCTGCCAAGACTATTGCAGAT pLKO_005 193 CDS 100% 4.050 2.835 N CCT3 n/a
10 TRCN0000157446 GTGTAAATGGTGAGACGGGTA pLKO.1 1544 CDS 100% 2.160 1.512 N CCT3 n/a
11 TRCN0000154796 GCGTGGAGTCATGATTAACAA pLKO.1 753 CDS 100% 5.625 3.375 N CCT3 n/a
12 TRCN0000352949 GCGTGGAGTCATGATTAACAA pLKO_005 753 CDS 100% 5.625 3.375 N CCT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005998.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10206 pDONR223 100% 99.8% 99.8% None 1_3delATG n/a
2 ccsbBroad304_10206 pLX_304 0% 99.8% 99.8% V5 1_3delATG n/a
3 TRCN0000470018 TATAGGTGATCGAGTCATGACCCC pLX_317 24.6% 99.8% 99.8% V5 1_3delATG n/a
Download CSV