Transcript: Human NM_006136.3

Homo sapiens capping actin protein of muscle Z-line subunit alpha 2 (CAPZA2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
CAPZA2 (830)
Length:
5068
CDS:
26..886

Additional Resources:

NCBI RefSeq record:
NM_006136.3
NBCI Gene record:
CAPZA2 (830)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116314 GTTGCCAGTTACACGCACTAA pLKO.1 808 CDS 100% 4.950 6.930 N CAPZA2 n/a
2 TRCN0000315720 GTTGCCAGTTACACGCACTAA pLKO_005 808 CDS 100% 4.950 6.930 N CAPZA2 n/a
3 TRCN0000116313 GCCAGTTACACGCACTAAGAT pLKO.1 811 CDS 100% 5.625 4.500 N CAPZA2 n/a
4 TRCN0000376006 ACTGCCATCAGTGAGAATTAT pLKO_005 746 CDS 100% 15.000 10.500 N Capza2 n/a
5 TRCN0000303492 CTTAGCTAATCAACCATTATT pLKO_005 1032 3UTR 100% 15.000 10.500 N CAPZA2 n/a
6 TRCN0000303560 TGTTCGGTTACTGCTTAATAA pLKO_005 130 CDS 100% 15.000 10.500 N CAPZA2 n/a
7 TRCN0000116312 CCTGTGGTGAATGTTAGTATT pLKO.1 1962 3UTR 100% 13.200 9.240 N CAPZA2 n/a
8 TRCN0000116315 CAGTATAACTTGGACCAGTTT pLKO.1 191 CDS 100% 4.950 3.465 N CAPZA2 n/a
9 TRCN0000315721 CAGTATAACTTGGACCAGTTT pLKO_005 191 CDS 100% 4.950 3.465 N CAPZA2 n/a
10 TRCN0000116316 GCAAACCATTATTGCATGCAT pLKO.1 478 CDS 100% 3.000 2.100 N CAPZA2 n/a
11 TRCN0000303493 ATGAAGAGAAGGTGCGTATAG pLKO_005 54 CDS 100% 10.800 6.480 N CAPZA2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4143 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3001 3UTR 100% 4.950 2.475 Y CFLAR n/a
14 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3001 3UTR 100% 4.950 2.475 Y C19orf31 n/a
15 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 4439 3UTR 100% 4.950 2.475 Y NPHS1 n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2999 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2999 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2999 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4305 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006136.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05935 pDONR223 100% 99.8% 100% None 330C>A n/a
2 ccsbBroad304_05935 pLX_304 0% 99.8% 100% V5 330C>A n/a
3 TRCN0000471892 AGTTACTATACTAATTTTAATAAG pLX_317 53.1% 99.8% 100% V5 330C>A n/a
Download CSV