Transcript: Human NM_006223.4

Homo sapiens peptidylprolyl cis/trans isomerase, NIMA-interacting 4 (PIN4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PIN4 (5303)
Length:
1239
CDS:
30..425

Additional Resources:

NCBI RefSeq record:
NM_006223.4
NBCI Gene record:
PIN4 (5303)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006223.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312558 CTCTCAGTCTGTCCCATAAAT pLKO_005 710 3UTR 100% 15.000 10.500 N PIN4 n/a
2 TRCN0000049220 GCCTGTAAGTGGGATGGATAA pLKO.1 332 CDS 100% 10.800 7.560 N PIN4 n/a
3 TRCN0000252599 GCCTGTAAGTGGGATGGATAA pLKO_005 332 CDS 100% 10.800 7.560 N Pin4 n/a
4 TRCN0000327792 GCCTGTAAGTGGGATGGATAA pLKO_005 332 CDS 100% 10.800 7.560 N PIN4 n/a
5 TRCN0000049218 CCGCACAGTATAGTGAAGATA pLKO.1 232 CDS 100% 5.625 3.938 N PIN4 n/a
6 TRCN0000327765 CCGCACAGTATAGTGAAGATA pLKO_005 232 CDS 100% 5.625 3.938 N PIN4 n/a
7 TRCN0000049222 GTCAGACACATTCTATGTGAA pLKO.1 147 CDS 100% 4.950 2.970 N PIN4 n/a
8 TRCN0000327689 GTCAGACACATTCTATGTGAA pLKO_005 147 CDS 100% 4.950 2.970 N PIN4 n/a
9 TRCN0000353246 CAGTAAAGGTCAGACACATTC pLKO_005 139 CDS 100% 10.800 5.400 Y Pin4 n/a
10 TRCN0000346213 TTAAAGTCTGGGATGAGATTC pLKO_005 201 CDS 100% 10.800 5.400 Y Pin4 n/a
11 TRCN0000049219 GCAGTAAAGGTCAGACACATT pLKO.1 138 CDS 100% 4.950 2.475 Y PIN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006223.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15529 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15529 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471417 TATTTTCACACTCGAGTTCGACGA pLX_317 100% 99.7% 100% V5 381C>T n/a
4 ccsbBroadEn_06729 pDONR223 100% 83.9% 83.9% None 0_1ins75 n/a
5 TRCN0000477942 TGTGTCAAGTAATCTTTCTAGAGG pLX_317 55.8% 83.9% 83.9% V5 0_1ins75 n/a
Download CSV