Transcript: Human NM_006609.5

Homo sapiens mitogen-activated protein kinase kinase kinase 2 (MAP3K2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-28
Taxon:
Homo sapiens (human)
Gene:
MAP3K2 (10746)
Length:
10871
CDS:
101..1960

Additional Resources:

NCBI RefSeq record:
NM_006609.5
NBCI Gene record:
MAP3K2 (10746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006609.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219715 AGTATGATGATAGTCGAATAA pLKO.1 1059 CDS 100% 13.200 18.480 N MAP3K2 n/a
2 TRCN0000332975 AGTATGATGATAGTCGAATAA pLKO_005 1059 CDS 100% 13.200 18.480 N MAP3K2 n/a
3 TRCN0000219713 GAACTGCTGGATCGTAGTATT pLKO.1 410 CDS 100% 13.200 18.480 N MAP3K2 n/a
4 TRCN0000002043 GCAACGTCAAACTAGGAGATT pLKO.1 1584 CDS 100% 4.950 6.930 N MAP3K2 n/a
5 TRCN0000344510 GCAACGTCAAACTAGGAGATT pLKO_005 1584 CDS 100% 4.950 6.930 N MAP3K2 n/a
6 TRCN0000195723 CAATCCTACTTTGACCGTAAT pLKO.1 1102 CDS 100% 10.800 8.640 N MAP3K2 n/a
7 TRCN0000344509 CAATCCTACTTTGACCGTAAT pLKO_005 1102 CDS 100% 10.800 8.640 N MAP3K2 n/a
8 TRCN0000195221 CCCAAGTGTGTGGATCTATTA pLKO.1 4215 3UTR 100% 13.200 9.240 N MAP3K2 n/a
9 TRCN0000219714 GTAGTGGAAGCAGTATCTTTA pLKO.1 1032 CDS 100% 13.200 9.240 N MAP3K2 n/a
10 TRCN0000332974 GTAGTGGAAGCAGTATCTTTA pLKO_005 1032 CDS 100% 13.200 9.240 N MAP3K2 n/a
11 TRCN0000025201 CCACCTCATGTCTCAGACTAT pLKO.1 1847 CDS 100% 4.950 3.465 N Map3k2 n/a
12 TRCN0000002045 CCTTTGGATGGAGAGAGCTAT pLKO.1 767 CDS 100% 4.950 3.465 N MAP3K2 n/a
13 TRCN0000002047 CAGAATACTAAAGCACCTCAA pLKO.1 3033 3UTR 100% 4.050 2.835 N MAP3K2 n/a
14 TRCN0000002044 CCAGATGAATTACACCAGGTT pLKO.1 611 CDS 100% 2.640 1.848 N MAP3K2 n/a
15 TRCN0000196879 GCATTCCCTGTAGGAATATTT pLKO.1 4039 3UTR 100% 1.500 1.050 N MAP3K2 n/a
16 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2665 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006609.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14974 pDONR223 87.2% 98.6% 34.5% None (many diffs) n/a
2 ccsbBroad304_14974 pLX_304 36.6% 98.6% 34.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468903 ATTTGGCAGTTAAACTTCTAGGGG pLX_317 19.3% 98.6% 34.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV