Transcript: Human NM_006703.4

Homo sapiens nudix hydrolase 3 (NUDT3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
NUDT3 (11165)
Length:
9900
CDS:
308..826

Additional Resources:

NCBI RefSeq record:
NM_006703.4
NBCI Gene record:
NUDT3 (11165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006703.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381064 CACAGGCCTCCTCTTTCAAAT pLKO_005 912 3UTR 100% 13.200 6.600 Y NUDT3 n/a
2 TRCN0000050583 TGGGAAGATTAGTTGGAATTT pLKO.1 537 CDS 100% 13.200 6.600 Y NUDT3 n/a
3 TRCN0000299497 TGGGAAGATTAGTTGGAATTT pLKO_005 537 CDS 100% 13.200 6.600 Y NUDT3 n/a
4 TRCN0000382242 AGTGTTCCTGTTTGTCTTATC pLKO_005 1139 3UTR 100% 10.800 5.400 Y NUDT3 n/a
5 TRCN0000380738 ATGTTGCTGTTTGGTGTTAAG pLKO_005 970 3UTR 100% 10.800 5.400 Y NUDT3 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2520 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2520 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6096 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000050586 GCTCGATGTCAGGCATCAGAT pLKO.1 804 CDS 100% 4.950 2.475 Y NUDT3 n/a
10 TRCN0000331660 GCTCGATGTCAGGCATCAGAT pLKO_005 804 CDS 100% 4.950 2.475 Y NUDT3 n/a
11 TRCN0000050585 GACGTATGTCTATGTGCTCAT pLKO.1 583 CDS 100% 4.050 2.025 Y NUDT3 n/a
12 TRCN0000299420 GACGTATGTCTATGTGCTCAT pLKO_005 583 CDS 100% 4.050 2.025 Y NUDT3 n/a
13 TRCN0000050584 TGAAACATTGAGGCAAGGCTA pLKO.1 727 CDS 100% 2.640 1.320 Y NUDT3 n/a
14 TRCN0000299498 TGAAACATTGAGGCAAGGCTA pLKO_005 727 CDS 100% 2.640 1.320 Y NUDT3 n/a
15 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2588 3UTR 100% 13.200 6.600 Y IQCC n/a
16 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6097 3UTR 100% 13.200 6.600 Y LIAS n/a
17 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2518 3UTR 100% 4.950 2.475 Y ERN2 n/a
18 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2518 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2518 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 6261 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006703.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02638 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02638 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478601 TCATGTTACCATGCAAAAGTGATG pLX_317 87.3% 100% 100% V5 n/a
Download CSV