Transcript: Human NM_006886.4

Homo sapiens ATP synthase F1 subunit epsilon (ATP5F1E), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ATP5F1E (514)
Length:
3610
CDS:
85..240

Additional Resources:

NCBI RefSeq record:
NM_006886.4
NBCI Gene record:
ATP5F1E (514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006886.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038216 GACTTCTGGCAGCAACGTAAA pLKO.1 195 CDS 100% 10.800 5.400 Y ATP5F1E n/a
2 TRCN0000291440 GACTTCTGGCAGCAACGTAAA pLKO_005 195 CDS 100% 10.800 5.400 Y ATP5F1E n/a
3 TRCN0000038215 CTACATCCGATACTCCCAGAT pLKO.1 117 CDS 100% 4.050 2.025 Y ATP5F1E n/a
4 TRCN0000291504 CTACATCCGATACTCCCAGAT pLKO_005 117 CDS 100% 4.050 2.025 Y ATP5F1E n/a
5 TRCN0000038218 AGCAGTGAGAGATGCACTGAA pLKO.1 147 CDS 100% 0.495 0.248 Y ATP5F1E n/a
6 TRCN0000291505 AGCAGTGAGAGATGCACTGAA pLKO_005 147 CDS 100% 0.495 0.248 Y ATP5F1E n/a
7 TRCN0000038217 GAAGACAGAATTCAAAGCAAA pLKO.1 165 CDS 100% 0.000 0.000 Y ATP5F1E n/a
8 TRCN0000038214 GCACTGAAGACAGAATTCAAA pLKO.1 160 CDS 100% 0.000 0.000 Y ATP5F1E n/a
9 TRCN0000291441 GCACTGAAGACAGAATTCAAA pLKO_005 160 CDS 100% 0.000 0.000 Y ATP5F1E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006886.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476723 TGCATGGCATGCCTTTTAGTAAAT pLX_317 100% 100% 100% V5 n/a
2 ccsbBroadEn_13818 pDONR223 100% 99.3% 66.6% None 103_104insA n/a
3 ccsbBroad304_13818 pLX_304 0% 99.3% 66.6% V5 (not translated due to prior stop codon) 103_104insA n/a
Download CSV