Transcript: Human NM_006915.3

Homo sapiens RP2 activator of ARL3 GTPase (RP2), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
RP2 (6102)
Length:
3700
CDS:
59..1111

Additional Resources:

NCBI RefSeq record:
NM_006915.3
NBCI Gene record:
RP2 (6102)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118801 CGAGATATTCAATGGGACCAA pLKO.1 1006 CDS 100% 2.640 3.696 N RP2 n/a
2 TRCN0000299656 CGAGATATTCAATGGGACCAA pLKO_005 1006 CDS 100% 2.640 3.696 N RP2 n/a
3 TRCN0000216349 GTGAGAACTGTAACATCTATA pLKO.1 258 CDS 100% 13.200 9.240 N Rp2 n/a
4 TRCN0000303755 TCTACAACTTTGCTGATATAC pLKO_005 1077 CDS 100% 13.200 9.240 N RP2 n/a
5 TRCN0000310759 TGTAGAAGTATGTCAACTTAT pLKO_005 979 CDS 100% 13.200 9.240 N RP2 n/a
6 TRCN0000118798 CCAAGATGTTTGTATCTGAAA pLKO.1 1023 CDS 100% 4.950 3.465 N RP2 n/a
7 TRCN0000299690 CCAAGATGTTTGTATCTGAAA pLKO_005 1023 CDS 100% 4.950 3.465 N RP2 n/a
8 TRCN0000118800 GTGGTATTATTTGCTGGTGAT pLKO.1 770 CDS 100% 4.050 2.835 N RP2 n/a
9 TRCN0000118797 GCTAAATTAAAGGGACTCCAT pLKO.1 2772 3UTR 100% 2.640 1.848 N RP2 n/a
10 TRCN0000299689 GCTAAATTAAAGGGACTCCAT pLKO_005 2772 3UTR 100% 2.640 1.848 N RP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006915.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01412 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01412 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473429 GTAAATGTGGGTTCTTCTCTCCTT pLX_317 36.6% 100% 100% V5 n/a
4 ccsbBroadEn_14829 pDONR223 0% 100% 100% None n/a
5 ccsbBroad304_14829 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000469591 GACCAACTCTGTTTCGCACCTGGG pLX_317 42.8% 100% 100% V5 n/a
Download CSV