Transcript: Human NM_007043.7

Homo sapiens KRR1 small subunit processome component homolog (KRR1), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
KRR1 (11103)
Length:
10104
CDS:
13..1158

Additional Resources:

NCBI RefSeq record:
NM_007043.7
NBCI Gene record:
KRR1 (11103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007043.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072295 GCATTGGAACTCTTAACTAAT pLKO.1 532 CDS 100% 13.200 9.240 N KRR1 n/a
2 TRCN0000289499 GCATTGGAACTCTTAACTAAT pLKO_005 532 CDS 100% 13.200 9.240 N KRR1 n/a
3 TRCN0000072296 GCAGCATGACTGTTTGTACTA pLKO.1 302 CDS 100% 4.950 3.465 N KRR1 n/a
4 TRCN0000289555 GCAGCATGACTGTTTGTACTA pLKO_005 302 CDS 100% 4.950 3.465 N KRR1 n/a
5 TRCN0000072293 GCCTGGATATACAACAGAGTA pLKO.1 2118 3UTR 100% 4.950 3.465 N KRR1 n/a
6 TRCN0000072294 GCCTTAAATGAACATCATGTT pLKO.1 256 CDS 100% 4.950 3.465 N KRR1 n/a
7 TRCN0000306840 GCCTTAAATGAACATCATGTT pLKO_005 256 CDS 100% 4.950 3.465 N KRR1 n/a
8 TRCN0000072297 ACAAAGCATTTATTCCACCTA pLKO.1 965 CDS 100% 2.640 1.584 N KRR1 n/a
9 TRCN0000289497 ACAAAGCATTTATTCCACCTA pLKO_005 965 CDS 100% 2.640 1.584 N KRR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007043.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07751 pDONR223 100% 99.9% 99.7% None 206A>G n/a
2 ccsbBroad304_07751 pLX_304 0% 99.9% 99.7% V5 206A>G n/a
3 TRCN0000469540 CACACAGACACCCCGAGGCTCCTT pLX_317 39.4% 99.9% 99.7% V5 206A>G n/a
4 ccsbBroadEn_07752 pDONR223 100% 99.8% 99.7% None 126A>G;617T>C n/a
5 ccsbBroad304_07752 pLX_304 0% 99.8% 99.7% V5 126A>G;617T>C n/a
6 TRCN0000473441 CATCTCTCAGTACAGCCTGTAGCC pLX_317 38.6% 99.8% 99.7% V5 126A>G;617T>C n/a
7 ccsbBroadEn_07753 pDONR223 100% 99.7% 99.4% None 741A>G;824A>G;1015A>G n/a
8 ccsbBroad304_07753 pLX_304 0% 99.7% 99.4% V5 741A>G;824A>G;1015A>G n/a
Download CSV