Transcript: Human NM_007045.4

Homo sapiens FGFR1 oncogene partner (FGFR1OP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FGFR1OP (11116)
Length:
13956
CDS:
17..1216

Additional Resources:

NCBI RefSeq record:
NM_007045.4
NBCI Gene record:
FGFR1OP (11116)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007045.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294369 ATACCAAAGACGGTCGTTTAG pLKO_005 216 CDS 100% 10.800 15.120 N FGFR1OP n/a
2 TRCN0000084089 CGAGAGAATTTAGCCCGAGAT pLKO.1 335 CDS 100% 4.050 5.670 N FGFR1OP n/a
3 TRCN0000286955 CGAGAGAATTTAGCCCGAGAT pLKO_005 335 CDS 100% 4.050 5.670 N FGFR1OP n/a
4 TRCN0000084092 CAAGTAAGATACCAAGGTATA pLKO.1 528 CDS 100% 10.800 8.640 N FGFR1OP n/a
5 TRCN0000251868 CTGTGGGTGGACCCTTATTAT pLKO_005 381 CDS 100% 15.000 10.500 N Fgfr1op n/a
6 TRCN0000294394 CTGTGGGTGGACCCTTATTAT pLKO_005 381 CDS 100% 15.000 10.500 N FGFR1OP n/a
7 TRCN0000084088 GCATGATGAAAGGTGTCAATA pLKO.1 1516 3UTR 100% 13.200 9.240 N FGFR1OP n/a
8 TRCN0000286956 GCATGATGAAAGGTGTCAATA pLKO_005 1516 3UTR 100% 13.200 9.240 N FGFR1OP n/a
9 TRCN0000084091 CCAAGTAAGATACCAAGGTAT pLKO.1 527 CDS 100% 4.950 3.465 N FGFR1OP n/a
10 TRCN0000084090 CCCATTCCTAAGCCAGAGAAA pLKO.1 791 CDS 100% 4.950 3.465 N FGFR1OP n/a
11 TRCN0000286896 CCCATTCCTAAGCCAGAGAAA pLKO_005 791 CDS 100% 4.950 3.465 N FGFR1OP n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6707 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6708 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6618 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9364 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9364 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9364 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9366 3UTR 100% 4.950 2.475 Y CFLAR n/a
19 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9366 3UTR 100% 4.950 2.475 Y C19orf31 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6618 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007045.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07754 pDONR223 100% 94.8% 94.4% None 188A>G;517_576del;813G>T n/a
2 ccsbBroad304_07754 pLX_304 0% 94.8% 94.4% V5 188A>G;517_576del;813G>T n/a
3 TRCN0000468162 CGAAATTGTCCAGAAATAATCTCC pLX_317 34.7% 94.8% 94.4% V5 188A>G;517_576del;813G>T n/a
Download CSV