Transcript: Human NM_007363.5

Homo sapiens non-POU domain containing octamer binding (NONO), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
NONO (4841)
Length:
2661
CDS:
154..1569

Additional Resources:

NCBI RefSeq record:
NM_007363.5
NBCI Gene record:
NONO (4841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007363.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074562 CAGGCGAAGTCTTCATTCATA pLKO.1 452 CDS 100% 5.625 7.875 N NONO n/a
2 TRCN0000286628 CAGGCGAAGTCTTCATTCATA pLKO_005 452 CDS 100% 5.625 7.875 N NONO n/a
3 TRCN0000074560 GCAGGCGAAGTCTTCATTCAT pLKO.1 451 CDS 100% 5.625 4.500 N NONO n/a
4 TRCN0000074561 CCTCAGTATGTGTCCAACGAA pLKO.1 619 CDS 100% 3.000 2.400 N NONO n/a
5 TRCN0000294049 TCCAGAGAAGCTGGTTATAAA pLKO_005 861 CDS 100% 15.000 10.500 N NONO n/a
6 TRCN0000306863 TGAGCACCAGGTCATGCTAAT pLKO_005 1068 CDS 100% 10.800 7.560 N NONO n/a
7 TRCN0000074558 GCCAGAATTCTACCCTGGAAA pLKO.1 1626 3UTR 100% 0.000 0.000 N NONO n/a
8 TRCN0000286693 GCCAGAATTCTACCCTGGAAA pLKO_005 1626 3UTR 100% 0.000 0.000 N NONO n/a
9 TRCN0000074559 GCTGCTACAATGGAAGGAATT pLKO.1 1465 CDS 100% 0.000 0.000 N NONO n/a
10 TRCN0000286627 GCTGCTACAATGGAAGGAATT pLKO_005 1465 CDS 100% 0.000 0.000 N NONO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007363.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01103 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01103 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_11000 pDONR223 100% 72.1% 72.1% None 1_393del n/a
4 ccsbBroad304_11000 pLX_304 0% 72.1% 72.1% V5 1_393del n/a
5 TRCN0000469986 CAGCTCGTTGATTAAAGCAGTTTT pLX_317 38.4% 72.1% 72.1% V5 1_393del n/a
Download CSV