Transcript: Mouse NM_007627.5

Mus musculus cholecystokinin B receptor (Cckbr), mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Cckbr (12426)
Length:
2589
CDS:
295..1656

Additional Resources:

NCBI RefSeq record:
NM_007627.5
NBCI Gene record:
Cckbr (12426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007627.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221819 CCAGTGAACGTGTCCAACAAA pLKO.1 923 CDS 100% 5.625 7.875 N Cckbr n/a
2 TRCN0000271772 CTCACCAGACCACATCATAAA pLKO_005 2215 3UTR 100% 13.200 9.240 N Cckbr n/a
3 TRCN0000221821 CTCCGCTTTGATGGTGATAAT pLKO.1 1039 CDS 100% 13.200 9.240 N Cckbr n/a
4 TRCN0000328362 TCCGCTTTGATGGTGATAATG pLKO_005 1040 CDS 100% 13.200 9.240 N Cckbr n/a
5 TRCN0000271748 CTCTGTCCAGGCTAAGCTATA pLKO_005 1607 CDS 100% 10.800 7.560 N Cckbr n/a
6 TRCN0000328476 GACCATTCGAATCACCCTTTA pLKO_005 456 CDS 100% 10.800 7.560 N Cckbr n/a
7 TRCN0000221818 CCCATTACATAGACAGACATA pLKO.1 1891 3UTR 100% 4.950 3.465 N Cckbr n/a
8 TRCN0000221820 CCCTATCTCTTTCATCCACTT pLKO.1 1422 CDS 100% 4.050 2.835 N Cckbr n/a
9 TRCN0000221822 GCGGTGATCTTTCTGATGAGT pLKO.1 478 CDS 100% 3.000 2.100 N Cckbr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007627.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05945 pDONR223 100% 83.9% 87.6% None (many diffs) n/a
2 ccsbBroad304_05945 pLX_304 0% 83.9% 87.6% V5 (many diffs) n/a
3 TRCN0000467911 ACTGGCAAGCTCCACCCTGCATCA pLX_317 21.8% 83.9% 87.6% V5 (many diffs) n/a
4 TRCN0000489736 CATATCTTAGGAAGGAATTCTCAA pLX_317 30.3% 83.9% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489791 GGGGCTCAAACATGTTCATGTGAC pLX_317 28.8% 83.9% 87.5% V5 (many diffs) n/a
Download CSV