Transcript: Mouse NM_008139.5

Mus musculus guanine nucleotide binding protein, alpha q polypeptide (Gnaq), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Gnaq (14682)
Length:
5634
CDS:
496..1575

Additional Resources:

NCBI RefSeq record:
NM_008139.5
NBCI Gene record:
Gnaq (14682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008139.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295413 CACTACAGGGATCATCGAATA pLKO_005 1050 CDS 100% 10.800 15.120 N Gnaq n/a
2 TRCN0000097887 GCTCGAGAATTCATCCTGAAA pLKO.1 1408 CDS 100% 0.000 0.000 N Gnaq n/a
3 TRCN0000287991 GCTCGAGAATTCATCCTGAAA pLKO_005 1408 CDS 100% 0.000 0.000 N Gnaq n/a
4 TRCN0000097885 GCCCTCTTGTAGCTTCTTTAT pLKO.1 2561 3UTR 100% 13.200 9.240 N Gnaq n/a
5 TRCN0000287919 GCCCTCTTGTAGCTTCTTTAT pLKO_005 2561 3UTR 100% 13.200 9.240 N Gnaq n/a
6 TRCN0000295412 TACGACAGACGACGGGAATAT pLKO_005 928 CDS 100% 13.200 9.240 N Gnaq n/a
7 TRCN0000097886 CCTTCCTATCTGCCTACACAA pLKO.1 1003 CDS 100% 4.950 3.465 N Gnaq n/a
8 TRCN0000097889 CTTAGCGAATATGATCAAGTT pLKO.1 1189 CDS 100% 4.950 3.465 N Gnaq n/a
9 TRCN0000097888 GCTTGTGGAATGATCCTGGAA pLKO.1 896 CDS 100% 2.640 1.584 N Gnaq n/a
10 TRCN0000287918 GCTTGTGGAATGATCCTGGAA pLKO_005 896 CDS 100% 2.640 1.584 N Gnaq n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008139.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00650 pDONR223 100% 80.5% 90.2% None (many diffs) n/a
2 ccsbBroad304_00650 pLX_304 0% 80.5% 90.2% V5 (many diffs) n/a
3 TRCN0000481250 AGCAATGTCGGCCTCTATCAGTAG pLX_317 35.8% 80.5% 90.2% V5 (many diffs) n/a
Download CSV