Transcript: Mouse NM_008269.1

Mus musculus homeobox B6 (Hoxb6), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Hoxb6 (15414)
Length:
1344
CDS:
7..681

Additional Resources:

NCBI RefSeq record:
NM_008269.1
NBCI Gene record:
Hoxb6 (15414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321403 ACAAGAGCGTGTTCGGAGAGA pLKO_005 338 CDS 100% 2.640 3.696 N Hoxb6 n/a
2 TRCN0000070864 GCATGAATTCGTGCAACAGTT pLKO.1 404 CDS 100% 0.000 0.000 N Hoxb6 n/a
3 TRCN0000321405 GCACGGTTCAATGGTAGATTC pLKO_005 1031 3UTR 100% 10.800 8.640 N Hoxb6 n/a
4 TRCN0000070866 CGCACAGGACAAGAGCGTGTT pLKO.1 330 CDS 100% 1.350 1.080 N Hoxb6 n/a
5 TRCN0000321402 TTTGCGGCGTCCTCCTATTAC pLKO_005 163 CDS 100% 13.200 9.240 N Hoxb6 n/a
6 TRCN0000070863 CGGCAGATCAAGATTTGGTTT pLKO.1 568 CDS 100% 4.950 3.465 N Hoxb6 n/a
7 TRCN0000321404 TTCGTGCAACAGTTCCTCTTT pLKO_005 411 CDS 100% 4.950 3.465 N Hoxb6 n/a
8 TRCN0000070865 GCCGCTCTACTCGTCTGGCTA pLKO.1 81 CDS 100% 0.000 0.000 N Hoxb6 n/a
9 TRCN0000070867 GCCTGCCTTCTACCGGGAGAA pLKO.1 237 CDS 100% 0.000 0.000 N Hoxb6 n/a
10 TRCN0000321474 CCGAGCGGCAGATCAAGATTT pLKO_005 563 CDS 100% 13.200 7.920 N Hoxb6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00776 pDONR223 100% 91.2% 97.7% None (many diffs) n/a
2 ccsbBroad304_00776 pLX_304 0% 91.2% 97.7% V5 (many diffs) n/a
3 TRCN0000473651 AGCCCAGTGTGTCACCACACTTCC pLX_317 55.2% 91.2% 97.7% V5 (many diffs) n/a
Download CSV