Transcript: Mouse NM_008309.5

Mus musculus 5-hydroxytryptamine (serotonin) receptor 1D (Htr1d), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Htr1d (15552)
Length:
2921
CDS:
968..2092

Additional Resources:

NCBI RefSeq record:
NM_008309.5
NBCI Gene record:
Htr1d (15552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008309.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221258 CGGGTTGATTTGTGCTATCTT pLKO.1 2184 3UTR 100% 5.625 7.875 N Htr1d n/a
2 TRCN0000221260 GCGTTTCAGAAAGTCGTCCAT pLKO.1 2054 CDS 100% 2.640 3.696 N Htr1d n/a
3 TRCN0000221261 CCGAGAAAGGAAAGCCACTAA pLKO.1 1840 CDS 100% 4.950 3.465 N Htr1d n/a
4 TRCN0000221259 CGCCTTCTATATCCCATCCAT pLKO.1 1570 CDS 100% 3.000 2.100 N Htr1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008309.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06416 pDONR223 100% 85% 90.1% None (many diffs) n/a
2 ccsbBroad304_06416 pLX_304 0% 85% 90.1% V5 (many diffs) n/a
3 TRCN0000466228 AGCATGCCTTTTACGACAAGATGG pLX_317 9.9% 85% 90.1% V5 (many diffs) n/a
4 TRCN0000489036 TCAGCCACCGAGATCGGTCCCGTA pLX_317 33.4% 85% 90.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000487810 TGCATCCGGATCGTACGTGCTCTC pLX_317 24.6% 84.9% 89.9% V5 (many diffs) n/a
Download CSV