Transcript: Mouse NM_008310.3

Mus musculus 5-hydroxytryptamine (serotonin) receptor 1F (Htr1f), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Htr1f (15557)
Length:
2509
CDS:
311..1411

Additional Resources:

NCBI RefSeq record:
NM_008310.3
NBCI Gene record:
Htr1f (15557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220754 CCCGCTTGTATTGATATTGAT pLKO.1 886 CDS 100% 5.625 7.875 N Htr1f n/a
2 TRCN0000220756 CGTGTGGGTTATATCTGTGTT pLKO.1 748 CDS 100% 4.950 6.930 N Htr1f n/a
3 TRCN0000416617 ATGCAGCTCAGCTCGTAATAT pLKO_005 1634 3UTR 100% 15.000 12.000 N Htr1f n/a
4 TRCN0000422208 ACTTGTACGATGCCGATATTA pLKO_005 1390 CDS 100% 15.000 10.500 N Htr1f n/a
5 TRCN0000414966 GTATTCATTTGGCCATAATTT pLKO_005 1585 3UTR 100% 15.000 10.500 N Htr1f n/a
6 TRCN0000220755 CCATCACAGATGCAGTTGAAT pLKO.1 681 CDS 100% 5.625 3.938 N Htr1f n/a
7 TRCN0000220757 GCCCTTCAGTATTGTGTACAT pLKO.1 541 CDS 100% 4.950 3.465 N Htr1f n/a
8 TRCN0000220758 GCTTTCTACATCCCGCTTGTA pLKO.1 875 CDS 100% 4.950 3.465 N Htr1f n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489611 TGCCGATGATATCCATACTTCAGC pLX_317 24.8% 87.9% 94.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489793 CGTGGTTAGAGCTGTGTCAAACCG pLX_317 38% 87.8% 94% V5 (many diffs) n/a
Download CSV