Transcript: Mouse NM_008449.2

Mus musculus kinesin family member 5C (Kif5c), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Kif5c (16574)
Length:
6867
CDS:
349..3219

Additional Resources:

NCBI RefSeq record:
NM_008449.2
NBCI Gene record:
Kif5c (16574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090857 GCAGGAAGTAGATCGCATCAA pLKO.1 3039 CDS 100% 4.950 3.960 N Kif5c n/a
2 TRCN0000354038 GCAGGAAGTAGATCGCATCAA pLKO_005 3039 CDS 100% 4.950 3.960 N Kif5c n/a
3 TRCN0000305903 CAAGGATTGCACATGATATTT pLKO_005 677 CDS 100% 15.000 10.500 N Kif5c n/a
4 TRCN0000090853 CCCAGTTGTTTGAACATCATT pLKO.1 3930 3UTR 100% 5.625 3.938 N Kif5c n/a
5 TRCN0000325140 CCCAGTTGTTTGAACATCATT pLKO_005 3930 3UTR 100% 5.625 3.938 N Kif5c n/a
6 TRCN0000090856 GCTAAAGACGAAGTGAAAGAA pLKO.1 1783 CDS 100% 5.625 3.938 N Kif5c n/a
7 TRCN0000090854 GCAGCTAAAGACGAAGTGAAA pLKO.1 1780 CDS 100% 4.950 3.465 N Kif5c n/a
8 TRCN0000354039 GCAGCTAAAGACGAAGTGAAA pLKO_005 1780 CDS 100% 4.950 3.465 N Kif5c n/a
9 TRCN0000090855 GCTGTGACAAACATGAACGAA pLKO.1 928 CDS 100% 3.000 2.100 N Kif5c n/a
10 TRCN0000311436 GTACCGACAGCTCGATGATAA pLKO_005 1617 CDS 100% 0.000 0.000 N Kif5c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13887 pDONR223 100% 67.1% 73.4% None (many diffs) n/a
2 ccsbBroad304_13887 pLX_304 0% 67.1% 73.4% V5 (many diffs) n/a
3 TRCN0000477266 TAGACTGAGATACTATTTATCGAA pLX_317 14.1% 67.1% 73.4% V5 (many diffs) n/a
Download CSV