Transcript: Mouse NM_008466.5

Mus musculus karyopherin (importin) alpha 3 (Kpna3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Kpna3 (16648)
Length:
4167
CDS:
157..1722

Additional Resources:

NCBI RefSeq record:
NM_008466.5
NBCI Gene record:
Kpna3 (16648)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008466.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366405 CATCTACCATACGGACATAAA pLKO_005 906 CDS 100% 13.200 18.480 N Kpna3 n/a
2 TRCN0000375210 CTTGGGCAATTAGCAACTTAA pLKO_005 1322 CDS 100% 13.200 18.480 N Kpna3 n/a
3 TRCN0000375274 CAGATGGCCACCAAGCGATAA pLKO_005 1766 3UTR 100% 10.800 15.120 N Kpna3 n/a
4 TRCN0000093568 CTGTAATAGATGCTGGGTTAA pLKO.1 1244 CDS 100% 10.800 15.120 N Kpna3 n/a
5 TRCN0000375209 GGAACGTCACATGGGTCATTG pLKO_005 809 CDS 100% 10.800 15.120 N Kpna3 n/a
6 TRCN0000293950 TTGTCCTCCACAAACATATTT pLKO_005 2155 3UTR 100% 15.000 12.000 N KPNA3 n/a
7 TRCN0000366474 TGTAACACTAGAAGCTATATT pLKO_005 366 CDS 100% 15.000 10.500 N Kpna3 n/a
8 TRCN0000366407 GAGCAAATACAGATGGTTATT pLKO_005 979 CDS 100% 13.200 9.240 N Kpna3 n/a
9 TRCN0000093564 GCAGCATCTTTCATTCAATAT pLKO.1 1735 3UTR 100% 13.200 9.240 N Kpna3 n/a
10 TRCN0000093567 GCAGGCAGCAAGGAAACTATT pLKO.1 432 CDS 100% 13.200 9.240 N Kpna3 n/a
11 TRCN0000065322 CCACATCAGAATGTTTGTGAA pLKO.1 661 CDS 100% 4.950 3.465 N KPNA3 n/a
12 TRCN0000286474 CCACATCAGAATGTTTGTGAA pLKO_005 661 CDS 100% 4.950 3.465 N KPNA3 n/a
13 TRCN0000093566 GCAGAACGTAATACCACCATT pLKO.1 1383 CDS 100% 4.950 3.465 N Kpna3 n/a
14 TRCN0000093565 GCTGTAATAGATGCTGGGTTA pLKO.1 1243 CDS 100% 4.050 2.835 N Kpna3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008466.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06502 pDONR223 100% 93.2% 98.4% None (many diffs) n/a
2 ccsbBroad304_06502 pLX_304 0% 93.2% 98.4% V5 (many diffs) n/a
3 TRCN0000478199 TCGGTTCTCAAACTCTCAATGTTG pLX_317 16.4% 93.2% 98.4% V5 (many diffs) n/a
Download CSV