Transcript: Mouse NM_008516.4

Mus musculus leucine rich repeat protein 1, neuronal (Lrrn1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lrrn1 (16979)
Length:
3756
CDS:
771..2921

Additional Resources:

NCBI RefSeq record:
NM_008516.4
NBCI Gene record:
Lrrn1 (16979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008516.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108483 GAAATAAGATAACCGTGGAAA pLKO.1 2161 CDS 100% 4.950 6.930 N Lrrn1 n/a
2 TRCN0000108484 GCCTAGTGTTAGCAGGAATGT pLKO.1 1426 CDS 100% 4.950 6.930 N Lrrn1 n/a
3 TRCN0000108481 CCAGAACAACTTTACAAACAT pLKO.1 1079 CDS 100% 5.625 3.938 N Lrrn1 n/a
4 TRCN0000108480 GCTACTTTGTTGAATGATGTT pLKO.1 3420 3UTR 100% 4.950 3.465 N Lrrn1 n/a
5 TRCN0000108482 CCACTCATTAACCTCTGGGAA pLKO.1 2817 CDS 100% 2.640 1.848 N Lrrn1 n/a
6 TRCN0000158312 CCACTCATTAACCTCTGGGAA pLKO.1 2817 CDS 100% 2.640 1.848 N LRRN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008516.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08752 pDONR223 100% 87.4% 95.3% None (many diffs) n/a
2 ccsbBroad304_08752 pLX_304 0% 87.4% 95.3% V5 (many diffs) n/a
3 TRCN0000491979 GCGATTTTTTGTTGCACCATTCAT pLX_317 14% 87.4% 95.3% V5 (many diffs) n/a
Download CSV