Transcript: Mouse NM_009190.2

Mus musculus vacuolar protein sorting 4B (Vps4b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Vps4b (20479)
Length:
3272
CDS:
279..1613

Additional Resources:

NCBI RefSeq record:
NM_009190.2
NBCI Gene record:
Vps4b (20479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311569 CGAGGCTGCACGGAGAATTAA pLKO_005 1022 CDS 100% 15.000 21.000 N Vps4b n/a
2 TRCN0000101418 GCGAAGATTTGAGAAACGTAT pLKO.1 1145 CDS 100% 4.950 3.960 N Vps4b n/a
3 TRCN0000354237 GCGAAGATTTGAGAAACGTAT pLKO_005 1145 CDS 100% 4.950 3.960 N Vps4b n/a
4 TRCN0000306504 ACGCAGAGCACTGATGAATTT pLKO_005 2082 3UTR 100% 13.200 9.240 N Vps4b n/a
5 TRCN0000311567 GCACAAAGCCAACAGTCAATG pLKO_005 1537 CDS 100% 10.800 7.560 N Vps4b n/a
6 TRCN0000379997 GCCAGGAAGGCTAACACAAAG pLKO_005 1600 CDS 100% 10.800 7.560 N Vps4b n/a
7 TRCN0000101416 GCTGATCCTAACTGCATTGTA pLKO.1 1389 CDS 100% 5.625 3.938 N Vps4b n/a
8 TRCN0000354161 GCTGATCCTAACTGCATTGTA pLKO_005 1389 CDS 100% 5.625 3.938 N Vps4b n/a
9 TRCN0000380278 AGTTCAGTCAGCTACTCACTT pLKO_005 1343 CDS 100% 4.950 3.465 N Vps4b n/a
10 TRCN0000101419 GCTCTTAAAGAGGCTGTGATT pLKO.1 711 CDS 100% 4.950 3.465 N Vps4b n/a
11 TRCN0000101415 CCTGCAAACAATTACTAGGTT pLKO.1 2688 3UTR 100% 3.000 2.100 N Vps4b n/a
12 TRCN0000101417 CCAGTTGTTTCCATGTGGGAT pLKO.1 1497 CDS 100% 2.640 1.848 N Vps4b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02185 pDONR223 100% 88.4% 95.4% None (many diffs) n/a
2 TRCN0000479683 ACACCGAGTCGGATATACAAATCC pLX_317 29% 88.4% 95.4% V5 (many diffs) n/a
Download CSV