Transcript: Mouse NM_009439.1

Mus musculus proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 (Psmd3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Psmd3 (22123)
Length:
2167
CDS:
177..1769

Additional Resources:

NCBI RefSeq record:
NM_009439.1
NBCI Gene record:
Psmd3 (22123)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066120 CCTCTATTACACAGGGCGAAT pLKO.1 1028 CDS 100% 4.050 5.670 N Psmd3 n/a
2 TRCN0000066118 CGCTACAAAGAGGCACAGAAA pLKO.1 702 CDS 100% 4.950 3.960 N Psmd3 n/a
3 TRCN0000066122 CGTCCAATCCAAAGAGATGAT pLKO.1 1535 CDS 100% 4.950 3.960 N Psmd3 n/a
4 TRCN0000066121 CCTCAACCACTATGTTCTGTA pLKO.1 485 CDS 100% 4.950 3.465 N Psmd3 n/a
5 TRCN0000066119 GCTTCGGAATTACCTGCACTA pLKO.1 926 CDS 100% 4.050 2.835 N Psmd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01319 pDONR223 100% 89.4% 97.3% None (many diffs) n/a
2 ccsbBroad304_01319 pLX_304 0% 89.4% 97.3% V5 (many diffs) n/a
3 TRCN0000480751 CAGAGAATCGGCTTGTTTCGTGAC pLX_317 22.4% 89.4% 97.3% V5 (many diffs) n/a
4 ccsbBroadEn_06805 pDONR223 100% 89.3% 97.3% None (many diffs) n/a
5 ccsbBroad304_06805 pLX_304 0% 89.3% 97.3% V5 (many diffs) n/a
6 TRCN0000473375 AAACAAAAGTAATTTTGTTGCTCT pLX_317 32.4% 89.3% 97.3% V5 (many diffs) n/a
7 ccsbBroadEn_06806 pDONR223 100% 89.3% 97.1% None (many diffs) n/a
8 ccsbBroad304_06806 pLX_304 0% 89.3% 97.1% V5 (many diffs) n/a
9 TRCN0000472036 TCTCGCTGACATTAACTACATGCA pLX_317 29.6% 89.3% 97.1% V5 (many diffs) n/a
10 ccsbBroadEn_06807 pDONR223 100% 89.3% 97% None (many diffs) n/a
11 ccsbBroad304_06807 pLX_304 0% 89.3% 97% V5 (many diffs) n/a
12 TRCN0000471844 TAGCCACTAGGAAGTCCACTATCT pLX_317 32.4% 89.3% 97% V5 (many diffs) n/a
Download CSV