Transcript: Mouse NM_009594.4

Mus musculus c-abl oncogene 1, non-receptor tyrosine kinase (Abl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Abl1 (11350)
Length:
5933
CDS:
99..3470

Additional Resources:

NCBI RefSeq record:
NM_009594.4
NBCI Gene record:
Abl1 (11350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009594.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023355 GCAGTTTGACTCATCCACCTT pLKO.1 2330 CDS 100% 2.640 3.696 N Abl1 n/a
2 TRCN0000321819 CAGGGCTCTTGTGCCTATAAA pLKO_005 3510 3UTR 100% 15.000 12.000 N Abl1 n/a
3 TRCN0000321753 CTCCGGGTCTTGGGTTATAAT pLKO_005 360 CDS 100% 15.000 12.000 N Abl1 n/a
4 TRCN0000023356 GTACACTTTCTGTGTGAGCTA pLKO.1 3266 CDS 100% 2.640 2.112 N Abl1 n/a
5 TRCN0000023354 CGTGTGGGCATTTGGAGTATT pLKO.1 1361 CDS 100% 13.200 9.240 N Abl1 n/a
6 TRCN0000321817 CGTGTGGGCATTTGGAGTATT pLKO_005 1361 CDS 100% 13.200 9.240 N Abl1 n/a
7 TRCN0000374364 GGAAGGAAGCTGTCGCTTTAA pLKO_005 3953 3UTR 100% 13.200 9.240 N Abl1 n/a
8 TRCN0000023358 CGAGGGCGTTTGGAAGAAGTA pLKO.1 869 CDS 100% 4.950 3.465 N Abl1 n/a
9 TRCN0000321816 CGAGGGCGTTTGGAAGAAGTA pLKO_005 869 CDS 100% 4.950 3.465 N Abl1 n/a
10 TRCN0000023357 AGACAGAAAGACCAACCTGTT pLKO.1 1877 CDS 100% 4.050 2.835 N Abl1 n/a
11 TRCN0000039900 GCTGAAATCCACCAAGCCTTT pLKO.1 1557 CDS 100% 4.050 2.835 N ABL1 n/a
12 TRCN0000332951 GCTGAAATCCACCAAGCCTTT pLKO_005 1557 CDS 100% 4.050 2.835 N ABL1 n/a
13 TRCN0000121098 CCAGTGGAGATAACACTCTAA pLKO.1 319 CDS 100% 4.950 3.465 N ABL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009594.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14525 pDONR223 0% 84.3% 87.7% None (many diffs) n/a
2 ccsbBroad304_14525 pLX_304 0% 84.3% 87.7% V5 (many diffs) n/a
3 TRCN0000474000 CGACTCCTGGAGTTTTTCATCTAT pLX_317 13.2% 84.2% 87.7% V5 (many diffs) n/a
4 TRCN0000491940 CAGCACAACACGTATGAATTGTCG pLX_317 9.5% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489115 CTGGTATAGCACCAATTGGAATTC pLX_317 10.2% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489646 CCAGTCTGCGTCTGTTACGCTGCG pLX_317 12% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488091 GTGAACTGATCCAACGTAAGCTCG pLX_317 10.2% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489555 TTAGATTATTATAAGACCCGGGCC pLX_317 11.6% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489612 CGATTCCTAACACCTTCTAACGTC pLX_317 12% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000487758 ACTTAAACCATCCTAGGAACAGTC pLX_317 8.6% 84.2% 87.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV