Transcript: Mouse NM_009626.4

Mus musculus alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide (Adh7), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Adh7 (11529)
Length:
2079
CDS:
119..1243

Additional Resources:

NCBI RefSeq record:
NM_009626.4
NBCI Gene record:
Adh7 (11529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009626.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042022 GCAACACCATACAGTATACTT pLKO.1 894 CDS 100% 5.625 7.875 N Adh7 n/a
2 TRCN0000308597 GCAACACCATACAGTATACTT pLKO_005 894 CDS 100% 5.625 7.875 N Adh7 n/a
3 TRCN0000042019 CGCACAGATGACCATATAATA pLKO.1 260 CDS 100% 15.000 10.500 N Adh7 n/a
4 TRCN0000308514 CGCACAGATGACCATATAATA pLKO_005 260 CDS 100% 15.000 10.500 N Adh7 n/a
5 TRCN0000042018 CCCTCTTTCTACCACAGTGTA pLKO.1 393 CDS 100% 4.950 3.465 N Adh7 n/a
6 TRCN0000308600 CCCTCTTTCTACCACAGTGTA pLKO_005 393 CDS 100% 4.950 3.465 N Adh7 n/a
7 TRCN0000042021 CCAGTTGATAACCCACACCTT pLKO.1 1147 CDS 100% 2.640 1.848 N Adh7 n/a
8 TRCN0000308515 CCAGTTGATAACCCACACCTT pLKO_005 1147 CDS 100% 2.640 1.848 N Adh7 n/a
9 TRCN0000042020 CCTCTCATCTTGCCATATGAA pLKO.1 952 CDS 100% 0.000 0.000 N Adh7 n/a
10 TRCN0000308601 CCTCTCATCTTGCCATATGAA pLKO_005 952 CDS 100% 0.000 0.000 N Adh7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009626.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00029 pDONR223 100% 82.9% 86.2% None (many diffs) n/a
2 ccsbBroad304_00029 pLX_304 0% 82.9% 86.2% V5 (many diffs) n/a
3 TRCN0000477122 ACACGGTGCCTTAGCACTTCCATG pLX_317 37.3% 82.9% 86.2% V5 (many diffs) n/a
Download CSV