Transcript: Mouse NM_009759.4

Mus musculus BMX non-receptor tyrosine kinase (Bmx), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Bmx (12169)
Length:
3005
CDS:
144..2111

Additional Resources:

NCBI RefSeq record:
NM_009759.4
NBCI Gene record:
Bmx (12169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009759.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023464 GCCCTATGACTTATATGATAA pLKO.1 1916 CDS 100% 13.200 18.480 N Bmx n/a
2 TRCN0000023468 CGGAGTATGCTCAAAGAAATA pLKO.1 1511 CDS 100% 13.200 10.560 N Bmx n/a
3 TRCN0000361075 ACCAGCAACATACGCTATATT pLKO_005 774 CDS 100% 15.000 10.500 N Bmx n/a
4 TRCN0000361073 GACTTTGGAATGACGAGATAT pLKO_005 1743 CDS 100% 13.200 9.240 N Bmx n/a
5 TRCN0000023467 CCTCACCTGTTGATCAAGTAT pLKO.1 495 CDS 100% 5.625 3.938 N Bmx n/a
6 TRCN0000023466 CCAACCAGCAACATACGCTAT pLKO.1 771 CDS 100% 4.050 2.835 N Bmx n/a
7 TRCN0000023465 CCAACATAATTCAGCAGGCAT pLKO.1 1214 CDS 100% 2.640 1.848 N Bmx n/a
8 TRCN0000361074 TGTACACTGTGTCCTTATTTA pLKO_005 1069 CDS 100% 15.000 9.000 N Bmx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009759.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05900 pDONR223 100% 85.3% 87% None (many diffs) n/a
2 ccsbBroad304_05900 pLX_304 0% 85.3% 87% V5 (many diffs) n/a
3 TRCN0000476849 GGCCCGTGTTTACACACAAGAATT pLX_317 18.5% 85.3% 87% V5 (many diffs) n/a
4 ccsbBroadEn_14552 pDONR223 0% 85.3% 87% None (many diffs) n/a
5 ccsbBroad304_14552 pLX_304 0% 85.3% 87% V5 (many diffs) n/a
6 TRCN0000480919 GTGGTCTCAGGGCTGCCCGAGAGT pLX_317 20.6% 85.3% 87% V5 (many diffs) n/a
7 TRCN0000488575 CACTTCTTCCTCCTATACAACCTT pLX_317 18.6% 85.3% 87% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000491668 CAGCGTATAACCGGCGGCCTCGTA pLX_317 14.7% 85.2% 86.9% V5 (many diffs) n/a
9 TRCN0000488720 TTTCTTAGATCGCCTGACTGGATT pLX_317 18.2% 85.2% 86.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV