Transcript: Mouse NM_009767.2

Mus musculus cysteine-rich hydrophobic domain 1 (Chic1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Chic1 (12212)
Length:
7401
CDS:
110..793

Additional Resources:

NCBI RefSeq record:
NM_009767.2
NBCI Gene record:
Chic1 (12212)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174882 GCAAACATATACCCGTATTTA pLKO.1 1017 3UTR 100% 15.000 21.000 N Chic1 n/a
2 TRCN0000262627 GAAATGTGAAACTAGCAATAT pLKO_005 712 CDS 100% 13.200 18.480 N CHIC1 n/a
3 TRCN0000174479 CGCTGTGTTCAATTTATTCTT pLKO.1 881 3UTR 100% 5.625 7.875 N Chic1 n/a
4 TRCN0000175875 GATACCGAATTTCCGTCAGTT pLKO.1 437 CDS 100% 4.950 6.930 N Chic1 n/a
5 TRCN0000173276 GCCCGTGATTTGTCTCAACAA pLKO.1 601 CDS 100% 4.950 6.930 N Chic1 n/a
6 TRCN0000174656 GCAACAAGTTTGATACCGAAT pLKO.1 426 CDS 100% 4.050 5.670 N Chic1 n/a
7 TRCN0000175505 CCACATCACTGTGTTTGGATT pLKO.1 403 CDS 100% 4.950 3.960 N Chic1 n/a
8 TRCN0000175575 CTCTCCCTGTCAATGTGAAAT pLKO.1 528 CDS 100% 13.200 9.240 N Chic1 n/a
9 TRCN0000219578 GAGCATGCTGCCTTATGATTT pLKO.1 1098 3UTR 100% 13.200 9.240 N Chic1 n/a
10 TRCN0000262626 GAGGAGCATCTGCGGAGATAT pLKO_005 350 CDS 100% 13.200 9.240 N CHIC1 n/a
11 TRCN0000193432 GAAGAATTTAAGACCAGCATT pLKO.1 479 CDS 100% 4.950 3.465 N Chic1 n/a
12 TRCN0000092942 GAAGATGAGGAGGAGGAAGAA pLKO.1 257 CDS 100% 4.950 2.475 Y Gm13232 n/a
13 TRCN0000075587 GAGGAAGAAGAGGAGGATGAA pLKO.1 269 CDS 100% 4.950 2.475 Y Hmgb2 n/a
14 TRCN0000173568 GAGGAAGAAGAGGAGGATGAA pLKO.1 269 CDS 100% 4.950 2.475 Y Chic1 n/a
15 TRCN0000301335 GAGGAAGAAGAGGAGGATGAA pLKO_005 269 CDS 100% 4.950 2.475 Y Hmgb2 n/a
16 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 303 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009767.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12019 pDONR223 100% 80.4% 84.7% None (many diffs) n/a
2 ccsbBroad304_12019 pLX_304 0% 80.4% 84.7% V5 (many diffs) n/a
3 TRCN0000477704 AAATCCCATCCGTCAGCCTCCAGA pLX_317 66.9% 80.4% 84.7% V5 (many diffs) n/a
Download CSV