Transcript: Mouse NM_009961.1

Mus musculus protocadherin alpha 10 (Pcdha10), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Pcdha10 (12943)
Length:
5242
CDS:
1..2841

Additional Resources:

NCBI RefSeq record:
NM_009961.1
NBCI Gene record:
Pcdha10 (12943)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094180 CGAAGGTTCAAATGGTCAAAT pLKO.1 813 CDS 100% 13.200 10.560 N Pcdha10 n/a
2 TRCN0000094182 CGAGCTTCAGAGCTTCACTTA pLKO.1 613 CDS 100% 4.950 3.960 N Pcdha10 n/a
3 TRCN0000094181 GAAGGTTCAAATGGTCAAATT pLKO.1 814 CDS 100% 13.200 9.240 N Pcdha10 n/a
4 TRCN0000094087 CGGTGAGTTGCCAGACAAATT pLKO.1 2631 CDS 100% 13.200 6.600 Y Pcdha6 n/a
5 TRCN0000094979 GCATCCTGTCTTGATGATATT pLKO.1 3160 3UTR 100% 13.200 6.600 Y Pcdha9 n/a
6 TRCN0000094984 GCCAGCAGTTCAAGCGTTTAA pLKO.1 3529 3UTR 100% 13.200 6.600 Y Pcdha12 n/a
7 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 3858 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
8 TRCN0000094349 CCTCACTTTATGCTGTTTGTT pLKO.1 3707 3UTR 100% 5.625 2.813 Y Pcdha4 n/a
9 TRCN0000094939 CGGAATATCAGCTTGTAGAAA pLKO.1 4692 3UTR 100% 5.625 2.813 Y Pcdhac2 n/a
10 TRCN0000094869 GCACAACTTAGATGTTTGATT pLKO.1 4761 3UTR 100% 5.625 2.813 Y Pcdhac1 n/a
11 TRCN0000094548 GCCTGCTAACAACCAAATTGA pLKO.1 2694 CDS 100% 5.625 2.813 Y Pcdha7 n/a
12 TRCN0000094089 CCGGAATATCAGCTTGTAGAA pLKO.1 4691 3UTR 100% 4.950 2.475 Y Pcdha1 n/a
13 TRCN0000094544 CGCTCCTTTCTCCTATGACAT pLKO.1 2915 3UTR 100% 4.950 2.475 Y Pcdha7 n/a
14 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 226 CDS 100% 4.950 2.475 Y PCDHA9 n/a
15 TRCN0000094699 GCCCTCAGAAATCTGCAGAAA pLKO.1 2938 3UTR 100% 4.950 2.475 Y Pcdha2 n/a
16 TRCN0000094086 GCTAACAACCAAATTGACAAA pLKO.1 2698 CDS 100% 4.950 2.475 Y Pcdha6 n/a
17 TRCN0000094179 GCTGGCTATAACATCACTGTA pLKO.1 3483 3UTR 100% 4.950 2.475 Y Pcdha10 n/a
18 TRCN0000094874 CCAAATGGAAACAAGCCACTT pLKO.1 2847 3UTR 100% 4.050 2.025 Y Pcdha8 n/a
19 TRCN0000094644 CCACCTTGTTTAGCTTTCCTT pLKO.1 4161 3UTR 100% 3.000 1.500 Y Pcdha11 n/a
20 TRCN0000094614 GCACTTTGATTACACAACCTT pLKO.1 4020 3UTR 100% 3.000 1.500 Y Pcdha3 n/a
21 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 2645 CDS 100% 2.640 1.320 Y Pcdha8 n/a
22 TRCN0000094183 CCCGGTGAGTTGCCAGACAAA pLKO.1 2629 CDS 100% 1.650 0.825 Y Pcdha10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009961.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.