Transcript: Mouse NM_010015.4

Mus musculus defender against cell death 1 (Dad1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Dad1 (13135)
Length:
3506
CDS:
88..429

Additional Resources:

NCBI RefSeq record:
NM_010015.4
NBCI Gene record:
Dad1 (13135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093700 GACGCCTATCTCCTTTATATA pLKO.1 169 CDS 100% 15.000 21.000 N Dad1 n/a
2 TRCN0000093703 GCAGCTTCATCCTAGCGGTTT pLKO.1 281 CDS 100% 4.050 5.670 N Dad1 n/a
3 TRCN0000287678 GCAGCTTCATCCTAGCGGTTT pLKO_005 281 CDS 100% 4.050 5.670 N Dad1 n/a
4 TRCN0000295028 AGGACCAGATGGGTAACATTC pLKO_005 861 3UTR 100% 10.800 8.640 N Dad1 n/a
5 TRCN0000295026 CCTGCACCTTGTCGTCATGAA pLKO_005 396 CDS 100% 4.950 3.960 N Dad1 n/a
6 TRCN0000083042 CTAGCGGTTTGCCTGAGAATA pLKO.1 292 CDS 100% 13.200 9.240 N DAD1 n/a
7 TRCN0000093702 CTGGACGCCTATCTCCTTTAT pLKO.1 166 CDS 100% 13.200 9.240 N Dad1 n/a
8 TRCN0000287677 CTGGACGCCTATCTCCTTTAT pLKO_005 166 CDS 100% 13.200 9.240 N Dad1 n/a
9 TRCN0000093701 CCTAGCGGTTTGCCTGAGAAT pLKO.1 291 CDS 100% 4.950 3.465 N Dad1 n/a
10 TRCN0000295094 GGTTCCTGGAGGAGTACTTGA pLKO_005 119 CDS 100% 4.950 3.465 N Dad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010015.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06080 pDONR223 100% 91.1% 99.1% None (many diffs) n/a
2 ccsbBroad304_06080 pLX_304 0% 91.1% 99.1% V5 (many diffs) n/a
3 TRCN0000480073 GGACCCGAACGTCACTGCTATACC pLX_317 100% 91.1% 99.1% V5 (many diffs) n/a
Download CSV