Transcript: Mouse NM_010098.3

Mus musculus opsin 3 (Opn3), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Opn3 (13603)
Length:
1783
CDS:
97..1299

Additional Resources:

NCBI RefSeq record:
NM_010098.3
NBCI Gene record:
Opn3 (13603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221333 CGACTGAGCAAGACAAATTAT pLKO.1 1443 3UTR 100% 15.000 21.000 N Opn3 n/a
2 TRCN0000221335 CGCATCTAAGGTCGATGTCAT pLKO.1 1260 CDS 100% 4.950 6.930 N Opn3 n/a
3 TRCN0000221336 GCAGCCTCTTTGGGTTCGTTT pLKO.1 452 CDS 100% 4.950 6.930 N Opn3 n/a
4 TRCN0000221337 CATTACCTATATCTGGCTCTA pLKO.1 561 CDS 100% 4.050 5.670 N Opn3 n/a
5 TRCN0000221334 CCCATCGTGATGTCACAGAAA pLKO.1 1135 CDS 100% 4.950 3.960 N Opn3 n/a
6 TRCN0000322403 GCTGGCCTATGAACGTTATAT pLKO_005 492 CDS 100% 15.000 10.500 N Opn3 n/a
7 TRCN0000322406 CTGGAGGGCCATTACCTATAT pLKO_005 552 CDS 100% 13.200 9.240 N Opn3 n/a
8 TRCN0000322405 ACAGGTACATCCTAGACATAC pLKO_005 620 CDS 100% 10.800 7.560 N Opn3 n/a
9 TRCN0000336089 GACAGAAGCAGCGCATCTAAG pLKO_005 1249 CDS 100% 10.800 7.560 N Opn3 n/a
10 TRCN0000322408 ATGGAAGACAGAGTCCTATAT pLKO_005 1302 3UTR 100% 13.200 7.920 N Opn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010098.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02806 pDONR223 100% 85% 87% None (many diffs) n/a
2 ccsbBroad304_02806 pLX_304 0% 85% 87% V5 (many diffs) n/a
3 TRCN0000468561 TCCACCCTGCGGGAGTGCATTACA pLX_317 32.2% 85% 87% V5 (many diffs) n/a
4 TRCN0000487981 GCCCATGCGTTCTCACGCCCGATT pLX_317 26.7% 85% 87% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV