Transcript: Mouse NM_010659.2

Mus musculus keratin 31 (Krt31), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Krt31 (16660)
Length:
1581
CDS:
70..1320

Additional Resources:

NCBI RefSeq record:
NM_010659.2
NBCI Gene record:
Krt31 (16660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416607 CAACTCCTTTGTACGCTAGAA pLKO_005 1302 CDS 100% 4.950 6.930 N Krt31 n/a
2 TRCN0000434064 ACTGGGCTTAGCACTCCAGAT pLKO_005 1350 3UTR 100% 4.050 3.240 N Krt31 n/a
3 TRCN0000089569 CAGAAGATCCTGTGCAGCAAA pLKO.1 412 CDS 100% 4.950 3.465 N Krt31 n/a
4 TRCN0000435546 GCGAAGGATCTTGGATGAGCT pLKO_005 555 CDS 100% 2.640 1.848 N Krt31 n/a
5 TRCN0000419930 ACAAGCAATGCATGCGGCAAG pLKO_005 1189 CDS 100% 2.250 1.575 N Krt31 n/a
6 TRCN0000415326 TATGAGACAGAGCTCGGTCTG pLKO_005 502 CDS 100% 2.250 1.575 N Krt31 n/a
7 TRCN0000089570 AGGTTGGTGGTGCAGATAGAT pLKO.1 445 CDS 100% 5.625 3.375 N Krt31 n/a
8 TRCN0000089568 ACCTGGTTCTGGTTCCACAAA pLKO.1 1376 3UTR 100% 4.950 2.970 N Krt31 n/a
9 TRCN0000089802 CATGAGAAACTCTCTGGAGAA pLKO.1 942 CDS 100% 4.050 2.025 Y Krt34 n/a
10 TRCN0000089571 GCAGCAAATCAGAGAATGCGA pLKO.1 425 CDS 100% 0.750 0.525 N Krt31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010659.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00920 pDONR223 100% 86.5% 89.9% None (many diffs) n/a
2 ccsbBroad304_00920 pLX_304 0% 86.5% 89.9% V5 (many diffs) n/a
3 TRCN0000467714 ATTAGCGGGGACGAAACGTTTAGA pLX_317 35% 86.5% 89.9% V5 (many diffs) n/a
4 ccsbBroadEn_00921 pDONR223 100% 84.4% 85% None (many diffs) n/a
5 ccsbBroad304_00921 pLX_304 0% 84.4% 85% V5 (many diffs) n/a
6 ccsbBroadEn_06510 pDONR223 100% 72.1% 73.1% None (many diffs) n/a
7 ccsbBroad304_06510 pLX_304 0% 72.1% 73.1% V5 (many diffs) n/a
8 TRCN0000477279 GGCACAGACCCCCTATCAGTTGAG pLX_317 24% 72.1% 73.1% V5 (many diffs) n/a
Download CSV