Transcript: Mouse NM_011145.3

Mus musculus peroxisome proliferator activator receptor delta (Ppard), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ppard (19015)
Length:
3240
CDS:
276..1598

Additional Resources:

NCBI RefSeq record:
NM_011145.3
NBCI Gene record:
Ppard (19015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026001 CTCGAGTATGAGAAGTGCGAT pLKO.1 588 CDS 100% 0.000 0.000 N Ppard n/a
2 TRCN0000026021 GAACCGCAACAAGTGTCAGTA pLKO.1 632 CDS 100% 4.950 3.465 N Ppard n/a
3 TRCN0000026031 GAAGGCCTTCTCTAAGCACAT pLKO.1 797 CDS 100% 4.050 2.835 N Ppard n/a
4 TRCN0000026007 GCTAAAGAAGACGGAGAGTGA pLKO.1 1529 CDS 100% 2.640 1.848 N Ppard n/a
5 TRCN0000026045 GCCCAGATGATGCAGTGGCTA pLKO.1 1512 CDS 100% 0.880 0.616 N Ppard n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011145.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488417 ATGCTCAACAGCCAACGAACTGGC pLX_317 28.9% 73% 75.2% V5 (many diffs) n/a
2 ccsbBroadEn_06754 pDONR223 100% 73% 75.2% None (many diffs) n/a
3 ccsbBroad304_06754 pLX_304 0% 73% 75.2% V5 (many diffs) n/a
4 TRCN0000470421 CTCTATGCCAAACTACCAATACAT pLX_317 35% 73% 75.2% V5 (many diffs) n/a
5 TRCN0000488494 TCCCTACTTCATCTTTCGAAAGCC pLX_317 20.4% 73% 75.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV