Transcript: Mouse NM_011184.5

Mus musculus proteasome (prosome, macropain) subunit, alpha type 3 (Psma3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Psma3 (19167)
Length:
2374
CDS:
125..892

Additional Resources:

NCBI RefSeq record:
NM_011184.5
NBCI Gene record:
Psma3 (19167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011184.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032219 CGGCTATAACATTCCTCTAAA pLKO.1 433 CDS 100% 13.200 18.480 N Psma3 n/a
2 TRCN0000363554 CGGCTATAACATTCCTCTAAA pLKO_005 433 CDS 100% 13.200 18.480 N Psma3 n/a
3 TRCN0000087413 CGACCCATCAGGTGTTTCATA pLKO.1 580 CDS 100% 5.625 7.875 N Gm5406 n/a
4 TRCN0000087454 GCTGCAAAGACAGAGATAGAA pLKO.1 638 CDS 100% 5.625 3.938 N Gm5406 n/a
5 TRCN0000032222 CCAAGTTGAATATGCCATGAA pLKO.1 190 CDS 100% 4.950 3.465 N Psma3 n/a
6 TRCN0000332839 CCAAGTTGAATATGCCATGAA pLKO_005 190 CDS 100% 4.950 3.465 N Psma3 n/a
7 TRCN0000032223 CGTGATGTAGTTAAAGAAGTT pLKO.1 686 CDS 100% 4.950 3.465 N Psma3 n/a
8 TRCN0000363555 CGTGATGTAGTTAAAGAAGTT pLKO_005 686 CDS 100% 4.950 3.465 N Psma3 n/a
9 TRCN0000032220 GCTCGTTCATTAGCAGACATA pLKO.1 377 CDS 100% 4.950 3.465 N Psma3 n/a
10 TRCN0000332756 GCTCGTTCATTAGCAGACATA pLKO_005 377 CDS 100% 4.950 3.465 N Psma3 n/a
11 TRCN0000087415 GCCATGTATGTACACGCCTAT pLKO.1 473 CDS 100% 4.050 2.835 N Gm5406 n/a
12 TRCN0000032221 GCAGAGAAATATGCCAAGGAA pLKO.1 830 CDS 100% 3.000 1.800 N Psma3 n/a
13 TRCN0000332838 GCAGAGAAATATGCCAAGGAA pLKO_005 830 CDS 100% 3.000 1.800 N Psma3 n/a
14 TRCN0000087457 GTATGACTTGTCAGCCTCTAT pLKO.1 145 CDS 100% 4.950 3.465 N Gm5406 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011184.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13931 pDONR223 100% 89.4% 51.9% None (many diffs) n/a
2 ccsbBroad304_13931 pLX_304 0% 89.4% 51.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_15542 pDONR223 0% 89.4% 96% None (many diffs) n/a
4 ccsbBroad304_15542 pLX_304 0% 89.4% 96% V5 (many diffs) n/a
Download CSV