Transcript: Mouse NM_011273.2

Mus musculus xenotropic and polytropic retrovirus receptor 1 (Xpr1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Mus musculus (mouse)
Gene:
Xpr1 (19775)
Length:
7651
CDS:
211..2298

Additional Resources:

NCBI RefSeq record:
NM_011273.2
NBCI Gene record:
Xpr1 (19775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240647 ATAGCAAACCTTCGGTTTATT pLKO_005 6592 3UTR 100% 15.000 21.000 N Xpr1 n/a
2 TRCN0000215357 CAAACTTCTGTTTCGAGTATT pLKO.1 1335 CDS 100% 13.200 18.480 N Xpr1 n/a
3 TRCN0000240646 CTCTATTACTGCTACGTTTAA pLKO_005 1941 CDS 100% 13.200 18.480 N Xpr1 n/a
4 TRCN0000216364 GATTATACTATTGCGTAAATG pLKO.1 5844 3UTR 100% 13.200 18.480 N Xpr1 n/a
5 TRCN0000240648 GCTCGCGACACTAAGGTATTG pLKO_005 2245 CDS 100% 10.800 15.120 N Xpr1 n/a
6 TRCN0000014302 GCGATTTGTGTGGAACTTCTT pLKO.1 2016 CDS 100% 4.950 6.930 N XPR1 n/a
7 TRCN0000193965 GTGGTCACCAATGAACTTGAA pLKO.1 811 CDS 100% 4.950 6.930 N Xpr1 n/a
8 TRCN0000240645 ACATTGCGACAGCGCAGAAAG pLKO_005 526 CDS 100% 10.800 7.560 N Xpr1 n/a
9 TRCN0000240644 CACTAGCCCTTTATGGGTTTA pLKO_005 1253 CDS 100% 10.800 7.560 N Xpr1 n/a
10 TRCN0000174417 CCAAGAAACAATTTGTCTCAT pLKO.1 1129 CDS 100% 4.950 3.465 N Xpr1 n/a
11 TRCN0000174623 GCATTCAAGGATATGCTGTAT pLKO.1 280 CDS 100% 4.950 3.465 N Xpr1 n/a
12 TRCN0000216204 CAGTAAGTGATGGAGTATATT pLKO.1 4714 3UTR 100% 15.000 9.000 N Xpr1 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7172 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011273.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487748 GCCGGCGACGTTAGTGAGACCTCG pLX_317 13.9% 92.2% 95.1% V5 (many diffs) n/a
2 ccsbBroadEn_02109 pDONR223 100% 84% 87% None (many diffs) n/a
3 ccsbBroad304_02109 pLX_304 0% 84% 87% V5 (many diffs) n/a
4 TRCN0000469141 GGAAATACCGTCAGAAGCAGGCCC pLX_317 24% 84% 87% V5 (many diffs) n/a
Download CSV