Transcript: Mouse NM_011296.2

Mus musculus ribosomal protein S18 (Rps18), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rps18 (20084)
Length:
524
CDS:
22..480

Additional Resources:

NCBI RefSeq record:
NM_011296.2
NBCI Gene record:
Rps18 (20084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074900 GCGAGTACTCAACACCAACAT pLKO.1 60 CDS 100% 4.950 3.465 N RPS18 n/a
2 TRCN0000290967 GCGAGTACTCAACACCAACAT pLKO_005 60 CDS 100% 4.950 3.465 N RPS18 n/a
3 TRCN0000074898 GCTCATGTGGTGTTGAGGAAA pLKO.1 142 CDS 100% 4.950 2.970 N RPS18 n/a
4 TRCN0000290966 GCTCATGTGGTGTTGAGGAAA pLKO_005 142 CDS 100% 4.950 2.970 N RPS18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011296.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01456 pDONR223 100% 91.8% 100% None (many diffs) n/a
2 ccsbBroad304_01456 pLX_304 0% 91.8% 100% V5 (many diffs) n/a
3 TRCN0000476505 ATGGACGCGGAGAATAGACAACCA pLX_317 74.1% 91.8% 100% V5 (many diffs) n/a
4 ccsbBroadEn_13726 pDONR223 100% 41.4% 45.3% None (many diffs) n/a
5 ccsbBroad304_13726 pLX_304 0% 41.4% 45.3% V5 (many diffs) n/a
6 TRCN0000476266 ATCTAGTTGATTGCCCCTGCAAAC pLX_317 100% 41.4% 45.3% V5 (many diffs) n/a
Download CSV