Transcript: Mouse NM_011299.4

Mus musculus ribosomal protein S6 kinase, polypeptide 2 (Rps6ka2), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Rps6ka2 (20112)
Length:
5435
CDS:
231..2432

Additional Resources:

NCBI RefSeq record:
NM_011299.4
NBCI Gene record:
Rps6ka2 (20112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011299.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022965 ACTCCATATCTGATGCAGCAA pLKO.1 2146 CDS 100% 2.640 3.696 N Rps6ka2 n/a
2 TRCN0000022967 TCGTGAACAGAGAGTACCTAT pLKO.1 2245 CDS 100% 4.950 3.960 N Rps6ka2 n/a
3 TRCN0000022709 CCCTGCTATACTGCAAACTTT pLKO.1 1941 CDS 100% 5.625 3.938 N Rps6ka2 n/a
4 TRCN0000022710 GAAACCAAGTAACATTCTGTA pLKO.1 1829 CDS 100% 4.950 3.465 N Rps6ka2 n/a
5 TRCN0000022713 GTCGTATGGAAAGGTGTTCTT pLKO.1 434 CDS 100% 4.950 3.465 N Rps6ka2 n/a
6 TRCN0000022968 TGAGGAGATTCTGGCTAGGAT pLKO.1 2087 CDS 100% 3.000 2.100 N Rps6ka2 n/a
7 TRCN0000022711 GCTTTCCAAAGAGGTGATGTT pLKO.1 677 CDS 100% 4.950 2.970 N Rps6ka2 n/a
8 TRCN0000022712 GCATGAAGAGACTCACGTCTA pLKO.1 2401 CDS 100% 4.050 2.025 Y Rps6ka2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011299.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487867 TATTGTCCAGCGGTTTTTGCCCCT pLX_317 8.8% 87.6% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14831 pDONR223 72.3% 87.2% 33.5% None (many diffs) n/a
3 ccsbBroad304_14831 pLX_304 0% 87.2% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV