Transcript: Mouse NM_011340.3

Mus musculus serine (or cysteine) peptidase inhibitor, clade F, member 1 (Serpinf1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Serpinf1 (20317)
Length:
1497
CDS:
136..1389

Additional Resources:

NCBI RefSeq record:
NM_011340.3
NBCI Gene record:
Serpinf1 (20317)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313900 TCACCTTCCCGCTAGACTATC pLKO_005 1277 CDS 100% 10.800 15.120 N Serpinf1 n/a
2 TRCN0000080335 CCCGCTAGACTATCACCTTAA pLKO.1 1284 CDS 100% 10.800 8.640 N Serpinf1 n/a
3 TRCN0000313966 TGAAGCTACAGTCGTTGTTTG pLKO_005 1127 CDS 100% 10.800 8.640 N Serpinf1 n/a
4 TRCN0000080336 CTTCGAGTCAAATCCAGCTTT pLKO.1 574 CDS 100% 4.950 3.960 N Serpinf1 n/a
5 TRCN0000313899 CACCCGACTTCAGCAAGATTA pLKO_005 1151 CDS 100% 13.200 9.240 N Serpinf1 n/a
6 TRCN0000313898 GAGCTTCGAAGGCGAACTTAC pLKO_005 1089 CDS 100% 10.800 7.560 N Serpinf1 n/a
7 TRCN0000080334 CGAGTCAAATCCAGCTTTGTT pLKO.1 577 CDS 100% 5.625 3.938 N Serpinf1 n/a
8 TRCN0000317557 CGAGTCAAATCCAGCTTTGTT pLKO_005 577 CDS 100% 5.625 3.938 N Serpinf1 n/a
9 TRCN0000080337 CCTCCTCTTCATAGGCAGAAT pLKO.1 1347 CDS 100% 4.950 3.465 N Serpinf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011340.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06710 pDONR223 100% 83.7% 85.9% None (many diffs) n/a
2 ccsbBroad304_06710 pLX_304 0% 83.7% 85.9% V5 (many diffs) n/a
3 TRCN0000474610 ATAAAACGCCTACGGAACGTTAGC pLX_317 33.5% 83.7% 85.9% V5 (many diffs) n/a
4 ccsbBroadEn_15521 pDONR223 0% 83.7% 85.6% None (many diffs) n/a
5 ccsbBroad304_15521 pLX_304 0% 83.7% 85.6% V5 (many diffs) n/a
6 TRCN0000466286 TGCTGCTAACGTGGTAAGAACGAG pLX_317 30% 83.7% 85.6% V5 (many diffs) n/a
Download CSV