Transcript: Mouse NM_011399.3

Mus musculus solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17 (Slc25a17), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc25a17 (20524)
Length:
1667
CDS:
36..959

Additional Resources:

NCBI RefSeq record:
NM_011399.3
NBCI Gene record:
Slc25a17 (20524)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102032 CGAGGATGGTTTCCAGTTATT pLKO.1 231 CDS 100% 13.200 18.480 N Slc25a17 n/a
2 TRCN0000068544 GCTTCTAAAGAAACGGATGAA pLKO.1 611 CDS 100% 4.950 6.930 N Slc25a17 n/a
3 TRCN0000068545 CCAACTAACTACAAAGGCATT pLKO.1 462 CDS 100% 4.050 5.670 N Slc25a17 n/a
4 TRCN0000102031 CCCTTGGATACTGCTAGACTT pLKO.1 120 CDS 100% 4.950 3.960 N Slc25a17 n/a
5 TRCN0000068543 CCTGCTTTAAGAAAGCTATTT pLKO.1 1441 3UTR 100% 13.200 9.240 N Slc25a17 n/a
6 TRCN0000102033 CTTTGGAATAATGGGACTCTA pLKO.1 815 CDS 100% 4.950 3.465 N Slc25a17 n/a
7 TRCN0000068546 GCCATCCAATTCATGTTCTAT pLKO.1 573 CDS 100% 5.625 3.375 N Slc25a17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02449 pDONR223 100% 88.3% 95.4% None (many diffs) n/a
2 ccsbBroad304_02449 pLX_304 0% 88.3% 95.4% V5 (many diffs) n/a
3 TRCN0000465602 ACCCGAAAACACTAATTGTTGGCA pLX_317 34.4% 88.3% 95.4% V5 (many diffs) n/a
Download CSV