Transcript: Mouse NM_011492.4

Mus musculus serine/threonine kinase 11 (Stk11), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Stk11 (20869)
Length:
2569
CDS:
816..2126

Additional Resources:

NCBI RefSeq record:
NM_011492.4
NBCI Gene record:
Stk11 (20869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285737 CATCGACTCCACCGAGGTAAT pLKO_005 899 CDS 100% 10.800 15.120 N Stk11 n/a
2 TRCN0000221241 CCCAAGGCTGTTTGTGTGAAT pLKO.1 1983 CDS 100% 4.950 3.465 N Stk11 n/a
3 TRCN0000274660 CCCAAGGCTGTTTGTGTGAAT pLKO_005 1983 CDS 100% 4.950 3.465 N Stk11 n/a
4 TRCN0000274659 CTGAGGCCTACAGTGTGTCAT pLKO_005 2127 CDS 100% 4.950 3.465 N Stk11 n/a
5 TRCN0000221239 GACAATATCTACAAGCTCTTT pLKO.1 1587 CDS 100% 4.950 3.465 N Stk11 n/a
6 TRCN0000323452 GACAATATCTACAAGCTCTTT pLKO_005 1587 CDS 100% 4.950 3.465 N Stk11 n/a
7 TRCN0000221240 GCAGAAGATGTATATGGTGAT pLKO.1 1181 CDS 100% 4.050 2.835 N Stk11 n/a
8 TRCN0000221242 CATCGGAATGTGATCCAGCTT pLKO.1 1134 CDS 100% 2.640 1.848 N Stk11 n/a
9 TRCN0000024148 CGCCAAGCTCATCGGCAAGTA pLKO.1 941 CDS 100% 1.650 1.155 N Stk11 n/a
10 TRCN0000274658 CGCCAAGCTCATCGGCAAGTA pLKO_005 941 CDS 100% 1.650 1.155 N Stk11 n/a
11 TRCN0000199913 GCCAAGCTCATCGGCAAGTAC pLKO.1 942 CDS 100% 1.650 1.155 N STK11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011492.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01613 pDONR223 100% 84.2% 89.4% None (many diffs) n/a
2 TRCN0000479821 TGAGCACCCCATCAACCAGAACCG pLX_317 27.9% 84.2% 89.4% V5 (many diffs) n/a
3 ccsbBroad304_01613 pLX_304 50.4% 84.2% 89.4% V5 (many diffs) n/a
4 ccsbBroadEn_14853 pDONR223 0% 84.2% 89.4% None (many diffs) n/a
5 ccsbBroad304_14853 pLX_304 41.5% 84.2% 89.4% V5 (many diffs) n/a
6 TRCN0000480906 TAATCTCTACCGGTACTACACCAA pLX_317 31.2% 84.2% 89.4% V5 (many diffs) n/a
7 TRCN0000489078 GTGGTACCGTTCCCTGATGAGAGA pLX_317 28% 84.2% 89.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV