Transcript: Mouse NM_011631.1

Mus musculus heat shock protein 90, beta (Grp94), member 1 (Hsp90b1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Hsp90b1 (22027)
Length:
2759
CDS:
90..2498

Additional Resources:

NCBI RefSeq record:
NM_011631.1
NBCI Gene record:
Hsp90b1 (22027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071925 GCTATTCAGTTGGATGGGTTA pLKO.1 252 CDS 100% 4.050 5.670 N Hsp90b1 n/a
2 TRCN0000312113 GCTATTCAGTTGGATGGGTTA pLKO_005 252 CDS 100% 4.050 5.670 N Hsp90b1 n/a
3 TRCN0000349817 GTGATTGAAGACCACTCAAAT pLKO_005 1575 CDS 100% 13.200 10.560 N Hsp90b1 n/a
4 TRCN0000071927 CCATAGCCAAATCTGGAACAA pLKO.1 583 CDS 100% 4.950 3.960 N Hsp90b1 n/a
5 TRCN0000071924 CCATGATATGATGCCCAAATA pLKO.1 1355 CDS 100% 13.200 9.240 N Hsp90b1 n/a
6 TRCN0000312114 CCATGATATGATGCCCAAATA pLKO_005 1355 CDS 100% 13.200 9.240 N Hsp90b1 n/a
7 TRCN0000313054 ATTATACTCTCGCTATGAATC pLKO_005 2499 CDS 100% 10.800 7.560 N Hsp90b1 n/a
8 TRCN0000071926 GCCCTCAAGGACAAGATAGAA pLKO.1 1965 CDS 100% 5.625 3.938 N Hsp90b1 n/a
9 TRCN0000312115 GCCCTCAAGGACAAGATAGAA pLKO_005 1965 CDS 100% 5.625 3.938 N Hsp90b1 n/a
10 TRCN0000071923 CGGCGGATTAAGGAAGATGAA pLKO.1 2184 CDS 100% 4.950 3.465 N Hsp90b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011631.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489328 AGTGAATAATCTACATCTGTAAAA pLX_317 14.6% 89.6% 97% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_13971 pDONR223 100% 35.4% 37.9% None (many diffs) n/a
3 ccsbBroad304_13971 pLX_304 0% 35.4% 37.9% V5 (many diffs) n/a
Download CSV